amp 8216 collective bio cultural heritage amp 8217 as the basis for tk protection
Tài liệu Carnivore Ecology and Conservation A Handbook of Techniques pptx
... proper sampling design, choose sampling methods, or assess logistics of the survey In sampling terms, the area chosen is the sampling frame, and the elements of the population therein represent the ... sampling units randomly selected for the survey among the total number available (U ) in the sampling frame; Ni is the value of the counts or measurements within sampling unit i; N is the sample ... based on the accessibility and other characteristics of the study area (i.e land cover, topography, climate) At xed costs, the larger the sampling area, the lower the sampling intensity and the...
- 508
- 584
- 1
Carnivore Ecology and Conservation: A Handbook of Techniques pptx
... proper sampling design, choose sampling methods, or assess logistics of the survey In sampling terms, the area chosen is the sampling frame, and the elements of the population therein represent the ... sampling units randomly selected for the survey among the total number available (U ) in the sampling frame; Ni is the value of the counts or measurements within sampling unit i; N is the sample ... based on the accessibility and other characteristics of the study area (i.e land cover, topography, climate) At xed costs, the larger the sampling area, the lower the sampling intensity and the...
- 508
- 461
- 0
Báo cáo y học: "Pravastatin Provides Antioxidant Activity and Protection of Erythrocytes Loaded Primaqe"
... solution was added to it This mixture was then centrifuged at 5000 rpm for 15 and the absorbance was measured at 532 nm Quantification of MDA levels was performed using tetraethoxypropane as the standard ... respectively On another side the maximum hemolysis of 94.8% for control erythrocytes, 98.4% for pravastatin, 99.5% for primaquine and 95.2% for the combination between pravastatin and primaquine was occurred ... oxidation as well as increase of erythrocytes TBARS as indicator for lipids peroxidation Pravastatin inhibits the oxidative stress induced by primaquine through normalization of TBARS as well as PCO...
- 8
- 537
- 0
Windows Home Server Protect and Simplify Your Digital Life
... Home Server for centralized storage and remote access Basics of user authentication are covered, as well as some ideas for how to ease the transition for households that are not used to the idea ... indicated which class the files were for The next tier indicated which week of class they belonged to Because most of our assignments were due on a weekly basis, I viewed each week as a separate ... including the date the file was created and the date it was last modified Some people also consider the filename to be metadata, but this generally depends on what information is put into the filename...
- 311
- 394
- 0
Tài liệu Physical Activity and Women’s Health pptx
... priorities for health promotion and disease prevention, increased physical activity and fitness leads the list If we could increase physical activity and decrease obesity, the reasoning goes, much of the ... not one disease, but many distinct, site-specific diseases To further complicate the situation, risk factors are specific to each disease Nevertheless, over the past decade, increasing evidence ... women as a primary preventive measure for major chronic disease? Will increasing physical activity reduce risk of disease and improve the health and wellness of women? Is physical activity as beneficial...
- 12
- 588
- 0
Tài liệu Time trends in leisure time physical activity and physical fitness in elderly people: 20 year followup of the Spanish population national health survey (1987-2006) docx
... useful for investigating patterns, frequencies, and time trends Finally, the use of objective measurements for assessing PA has changed over the last years, so the use of the same outcome for 20 ... 1997 were based on smaller sample sizes (N = 6,400), therefore these two databases were joined and analyzed together The number of subjects aged ≥ 65 years included in the study along the entire ... [38,39] For the purpose of the current study, we included answers from adults aged 65 years and older from these SNHS The variables included in the current study were created on the basis of...
- 11
- 912
- 0
Tài liệu Báo cáo khoa học: Secondary substrate binding strongly affects activity and binding affinity of Bacillus subtilis and Aspergillus niger GH11 xylanases docx
... independent of the strength of the SBS; for XAN, this is probably also the case, although, for a few mutations, the overall activity was seriously decreased Although the differences are small, the efficiency ... and M167V) in P pastoris, the pPicZaC-exlA plasmid was used [32] In both plasmids, a stop codon was incorporated after the last nucleotide encoding for the Cterminal amino acid of the native protein ... functionality of the SBS In some cases, the introduction of aromatic residues even lowered the screening ratio, as was seen for some of the XBS mutants Activity measurements After the screening...
- 14
- 600
- 0
Tài liệu Báo cáo khoa học: Processing, catalytic activity and crystal structures of kumamolisin-As with an engineered active site pptx
... clarify the structural basis for the preference of the enzyme for collagen [7] As in kumamolisin, the catalytic triad of kumamolisin -As is formed from Ser278, Glu78, and Asp82 The side chains of these ... enzyme activity for acidic pH (e.g Glu78) The involvement of the b-amide hydrogen of the Asn164 residue in the catalysis of D164N as well as the importance of Asp164 for the low-pH peptidase activity ... phosphate was used as the buffer component and the pH was varied from 2.5 to 8.0; the buffering capacity was sufficient for the present enzyme assays The wild-type enzyme, the mutants, and the IQF...
- 14
- 458
- 0
Tài liệu Báo cáo khoa học:Symmetric fluoro-substituted diol-based HIV protease inhibitors Ortho-fluorinated and meta-fluorinated P1/P1¢-benzyloxy side groups significantly improve the antiviral activity and preserve binding efficacyy docx
... activity/inhibition studies were performed as described by Nillroth et al [34] Briefly, a fluorimetric assay was used to determine the effects of the inhibitors on HIV-1 protease This assay used an internally ... [21] The protease gene was isolated by PCR with the upstream primer GAACA TATGGCCGATAGACAAGGAACTGTATCC and the downstream primer AGGGGATCCCTAAAAATTTAA AGTGCAACCAATCTG The annealing site for the ... acids before the protease sequence These extra amino acids were added to facilitate the autocatalytic processing of the precursor protein and thereby ensure a correct N-terminus Through the PCR...
- 9
- 560
- 0
Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf
... Accordingly, we assume that the aliphatic moiety of the introduced K in PAI-1(M149K) allows the side chain to adapt the same orientation as the original M and therefore the stabilizing effect of the M149K ... peptidolytic assay and expressed as percentage of the theoretical maximum The activity was monitored over time and the rate of latency transition expressed as the functional half-life, t½ The averages ... Alanine-scanning For each PAI-1 variant, the specific inhibitory activity towards uPA was determined in a peptidolytic assay and expressed as percentage of the theoretical maximum The activity was monitored...
- 9
- 605
- 0
Tài liệu Báo cáo khoa học: Changes in rat liver mitochondria with aging Lon protease-like activity and N e-carboxymethyllysine accumulation in the matrix doc
... sequence is 59 Lys, the error in the CML–adduct rate can be estimated to be as low as 2% The CML content was expressed as 0.644 nmol CML per lg BSA, and this solution was used as the standard in ... g and °C The supernatant was centrifuged at 8000 g for 10 at °C The mitochondrial pellet was washed three times with the homogenization medium and used for polarographic measurements For determination ... then at 100 000 g for 45 The supernatant (containing matrix protein) was stored at )80 °C for further determinations of protease activity and the level of carboxymethylated protein Protein was...
- 8
- 412
- 0
Tài liệu Báo cáo khoa học: Endotoxic activity and chemical structure of lipopolysaccharides from Chlamydia trachomatis serotypes E and L2 and Chlamydophila psittaci 6BC pdf
... min), the water phase was removed and the phenol phase was extracted again with 100 mL of 2% aqueous N-lauroylsarcosine sodium After centrifugation and separation as before, the extraction of the ... point 40–60 °C) : : (v/v/v) The organic solvents were evaporated and the LPS was precipitated from the phenol phase by drop-wise addition of water The precipitated LPS was washed once with 80% aqueous ... found in the late stage of the disease that is characterized by pannus formation and vascularization of the cornea There is good evidence that chlamydial heat shock proteins are involved in the immunopathology...
- 11
- 560
- 0
Báo cáo khoa học: Relationship between functional activity and protein stability in the presence of all classes of stabilizing osmolytes ppt
... have therefore measured the thermodynamic parameters of RNase-A in the presence of these amino acids and amino acid derivatives, and values of DGD°, measured in triplicate, are given in Table The ... on the addition of the osmolytes, the pH of each solution was also measured after each measurement It was observed that the change in pH was not significant Acknowledgements FA is grateful to the ... fraction in the presence of sugars is not as active as the original native molecules, whereas it is opposite in the presence of methylamines We therefore conclude that equilibrium shift is not the only...
- 9
- 547
- 0
Báo cáo khoa học: Haptoglobin binds the antiatherogenic protein apolipoprotein E – impairment of apolipoprotein E stimulation of both lecithin:cholesterol acyltransferase activity and cholesterol uptake by hepatocytes pdf
... during the acute phase of inflammation On the other hand, Hpt, in physiological conditions, might play a protective role for ApoE, as was reported for ApoA-I [15] On the basis of our results for ... transported by HDL to the liver for excretion in the bile Therefore, RCT is the major mechanism by which HDL protects against atherosclerosis and other cardiovascular diseases Stimulation of RCT ... ultimately, the thrombotic complications of the disease, was recently reviewed [1–3] The recognition of inflammation as a major cause of atherosclerosis has generated a sustained effort to investigate the...
- 14
- 445
- 0
Báo cáo khoa học: Simultaneous improvement of catalytic activity and thermal stability of tyrosine phenol-lyase by directed evolution ppt
... from the Escherichia coli library for the remaining activity, mutants AS1 AS7 were selected on the basis of a co-improvement in stability and activity For example, the T1 ⁄ values for AS4 and AS6 ... USA) The model with the best loop conformations was then selected using the Profiles-3D verification method, and the structure was optimized on Acknowledgements This project was supported by the Bio ... for the stability of the enzyme in this study In addition, the structural rationale for the other stability (E83K and T407A) and activity (T129I and T451A) mutations was investigated on the basis...
- 8
- 429
- 0
Báo cáo khoa học: Hyperthermophilic enzymes ) stability, activity and implementation strategies for high temperature applications pot
... a-Galactosidase Threonine (alcohol) dehydrogenase Alcohol dehydrogenase Carboxypeptidase Aminopeptidase Glukokinase Sucrose a-glucohydrolase Serine protease Thiol protease Metalloprotease b-1,4-endoglucanase ... respectively) as Topt increased Moreover, this increase in intrasubunit ion pairs was directly related to the relative decrease in neutral amino acids and a significant increase in polar amino acids (i.e Asp, ... citrate synthases from the hyperthermophilic Pyrococcus furiosus (Topt ¼ 100 °C), the thermophilic Thermoplasma acidophilum (Topt ¼ 55 °C), the mesophilic mammal (pig; Topt ¼ 37 °C), and the psychrophilic...
- 13
- 468
- 1
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... as it feeds through the core of an oligomeric ring formed by these AAA ATPases Thus many AAA ATPases function as protein disassembly machines [25] ATPase activity of Vps4 is critical for disassembling ... in the ATP hydrolysis site) Therefore, although the sequence at the end of the C-terminal helix is essential for ATPase activity and assembly in vitro, this requirement can be bypassed by the ... important One of these, the TRP sequence, includes the start of the C-terminal helix as well as the structured loop between the 1440 ATPase domain and the C-terminal helix and in the 3D structure...
- 23
- 490
- 0
Báo cáo khoa học: Engineering and characterization of human manganese superoxide dismutase mutants with high activity and low product inhibition potx
... only DNA polymerase used for the reassembly of DNase Idigested fragments, whereas an equal number of units of both Taq and Pfu DNA polymerases were used for the amplification of the reassembled product ... addition, a control transformation was performed together with each library, whereby the plasmid expressing Q143A hMnSOD was used to transform QC774 cells, and this transformant was plated onto a lm ... inactive form spectrophotometrically during the zero-order phase of catalysis, and, on the basis of visible absorption spectra of inorganic complexes, suggested that the zero-order phase results...
- 9
- 416
- 0
Báo cáo khoa học: Alpha-fetoprotein antagonizes X-linked inhibitor of apoptosis protein anticaspase activity and disrupts XIAP–caspase interaction ppt
... sucrose) for 15 at room temperature Thereafter the active recombinant caspase (3 nm) was added to the reaction mixture, and incubation continued for a further 15 under the same conditions For the ... the release of both caspase and caspase 9, as well as cIAP-2, from the apoptosome complex [28] It is possible that caspase cointeracts with AFP ⁄ XIAP complex similarly to caspase It is expected ... prevents XIAP ⁄ caspases complex formation Human recombinant XIAP was incubated for h at °C with mixed His-tagged active recombinant caspase and caspase in the presence of AFP or HSA as described...
- 13
- 445
- 0
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
... with the V5-His epitope) were either absent or extremely low An intact C-terminus is therefore indispensable for GCPII enzymatic activity, as the removal of as few as 15 amino acids from the C-terminus ... secreted into the media were substantially lower for the variants truncated further at the N-terminus (as compared to the 44/750 variant), and the 150/750 construct was not secreted at all The specific ... 10 lgÆmL)1 for the 44/750 and 1/750 variants A decrease of more than 80-fold in the secretion of recombinant protein was associated with the deletion of the C-terminal part(s) of the protein,...
- 9
- 414
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25