... xxv PART BIODIVERSITY, ECOSYSTEM SERVICES AND VALUATION Total Economic Valuation of Endangered Species: ASummaryandComparisonofUnitedStatesandRestoftheWorldEstimates Leslie Richardson ... Rights Act individual transferable quota International Union for the Conservation of Nature International Whaling Commission Kepasakapatan Konservasi Masyarakat large marine system least practical ... Percentage above randomc a ESV in randomly selected 1km2 cells, with the total area equivalent to that of each template b Maximum ESV attainable for the total area equivalent to that of each template...
... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS The oligonucleotide ... GDP, across the nuclear envelope regulates the binding and release of cargo by transport factors RanGTP is abundant in the nucleus as a result ofthe activity of RCC1, a guanine nucleotide exchange...
... Refflat file) and finally to non-coding RNA classes (fRNAdb, database of ncRNA.org): piwi-interacting RNA (piRNA), tRNA, rRNA, small nucleolar RNA (snoRNA) and other non-coding RNA (ncRNA) Reads ... Denmark), at a final concentration of 40 nM for each The sequences of these three DNA/LNA mixmers were 5’-CAGTCGGGGATGTTTAC-3’, 5’-CAGTCGAGGATGTTTAC-3’, and 5’-GAGTGTAGGATGTTTAC-3’ The simultaneous ... phosphorothioate backbone (Exiqon); the sequences were 5’ACATGAAGTAAACACACA-3’ for miR-30-TSB and 5’CAGTCGAAGCTGTTTAC-3’ for TSB-neg (mismatch control) TSBs were used at a concentration of 20 nM The day after...
... implementation ofthe IPM program, for the part ofthe TOT training and for the field data analyses Dr Pham Van Bien and Mr La Pham Lan are in charge of Vietnamese personnel and expenses ofthe project ... since the project started Baseline data ofthe insect pest assemblage and their damage were obtained Regular monitoring and sampling of insect pests and their natural enemies in the demonstration ... (Helopeltis antonii), that caused the majority of damage on flushing shoots The most important natural enemies were weaver ants (Oecophylla smaragdina) and crametogaster ants (Crematogaster sp) The effect...
... 59 Laguna A, Aranda S, Barallobre MJ, Barhoum R, ´ Fernandez E, Fotaki V, Delabar JM, de la Luna S, de ´ la Villa P & Arbones ML (2008) The protein kinase DYRK 1A regulates caspase-9-mediated apoptosis ... Bescond M & Rahmani Z (2005) Dual-specificity tyrosine-phosphorylated and regulated kinase 1A (DYRK 1A) interacts with the phytanoyl-CoA alphahydroxylase associated protein (PAHX-AP1), a brain specific ... mechanisms that regulate this translocation process (see also the interesting comments about the distribution of MNB ⁄ DYRK 1A in the adult mammalian brain in the accompanying review [9]) As previously...
... information ofthe role of aromatic moieties in amyloid fibril formation [36–41] A parameter-free model based on the mathematical analysis of many peptide fragments and their analogues had clearly ... state NMR study ofthe calcitonin hormone, mentioned above, demonstrated that the aromatic moieties of its central phenylalanines are aligned on the same side ofthe b-sheet and stabilize the ... carried out by Kapurniotu and coworkers [19] paved the way towards the present understanding ofthe mechanism of amyloid self-assembly The authors first discovered that a hexapeptide fragment of...
... isoforms [2] It consists of an N-terminal b-sandwich, a core (which contains a transamidation site anda Ca2+-binding site, and has a helices and b sheets in equal amounts), and two C-terminal ... to the manuscript, Drs Francesco Facchiano and Angelo Facchiano for their help in consulting the TRANSIT database, and Dr Eleonora Candi for her contribution in the preparation of Table We are ... extrusion of TG4 from the coagulating gland [129] FXIII Coagulation FXIII is a plasma TG, and circulates in blood as a heterotetramer consisting of two catalytic A (XIIIA) and two noncatalytic B...
... ofthe trees in the IPM plot, andthe small black ant, Tapinoma melanocephalum that was abundant on the remaining trees ofthe plot The Crematogaster ants were nesting on cashew tree branches and ... ants as a major component ofthe cashew IPM program At the end ofthe training, to examine the TOT trainee’s knowledge in cashew IPM and to get their feedback for each course andthe practicals we ... ants, ladybirds, preying mantis or birds These data clearly show that farmers lack extensive knowledge about the insect pests and diseases and their natural enemies Weaver ant status and farmers’...
... orchard preparation, controlling of competitive species of ants, identification of weaver ant colonies, transplantation ofthe ants into cashew orchards, and management and maintenance ofthe weaver ... include the following aspects: the main cashew insect pests and their control, the main cashew diseases and their management, the natural enemies in cashew orchards, the use of weaver ants in cashew ... in the TOT training, and they includes the following aspects: the main cashew insect pests and their control, the main cashew diseases and their management, the natural enemies in cashew orchards,...
... knowledge of cashew insect pests and diseases and their natural enemies, and Weaver ant status and farmers’ opinion of them The results are summarised below A total of 212 cashew farmers were ... insect pests and three diseases as well as many important species of natural enemies such as parasitoids and beneficial fungi in cashew orchards These data clearly show that farmers lack extensive ... farmers’ health andthe environment Farmers’ knowledge about the insect pests and diseases and their natural enemies in their own cashew orchards is poor Most orchards had weaver ants, but their...
... of ants, identification of weaver ant colonies, transplantation ofthe ants into cashew orchards, and management and maintenance ofthe weaver ant colonies Under the supervision of Dr Peng, they ... early damaged parts on trees a For stem borers, scrape off all the damaged material on the tree trunk including larvae and pupae, and then use appropriate chemicals to paint on the affected parts ... Monitoring and management ofthe main insect pests and diseases a Identify the main pests and diseases b Identify their damage symptoms c Assess the damage levels for the major pest by recording the damage...
... base, and each larva excavated a chamber in which the calcareous pupal cell was formed from the excretions ofthe larva Pupation took place late in the year The pupa is about 35 mm long, creamy-white, ... ants, it was attacked by several ghost ants, which grasped the legs, antenna and mandibles Two minutes later, two legs and two antenna ofthe weaver ant were cut off, resulting in the death of ... major ones after the main pests are controlled by weaver ants A total of 12 species of natural enemies of aphids and species of natural enemies of mealy bugs were determined, and these natural...
... methods and skills, and their understanding ofthe cashew IPM program A lot of farmers said that it was the best training they had received about cashews Although weaver ants are abundant, the farmers ... methods, and they were very interested in the field practical All the master trainers did their best to pass their knowledge to the TOT trainees A final examination at the end of each TOT training was ... in their orchards • The majority of them are planning to use weaver ants in part of their orchards in this coming season to have a further test and to further familiarise themselves with the ant...
... to manage the main pest assemblage andthe importance of keeping weaver ant populations high and stable • Part describes the basic bio-ecology of weaver ants and provides a series of practical ... the training methods, and about what they had learned and what they needed for the best management of their orchards He also answered a lot of questions raised by farmers At the end of each FFS ... demonstration orchards and their own orchards, the majority of FFS farmers will use weaver ants in part of their orchards in the next cashew season to have a test and to further familiarise themselves...
... of activity Acknowledgements We thank R Luna and AG Rondón for critical reading ofthe manuscript The work of AA’s laboratory is funded by the Spanish Ministry of Innovation and Junta de Andaluc a ... identified as a transcriptional activator that interacts with the SAGA transcription factor, opens up the possibility ofa co-transcriptional action of THO in higher eukaryotes [9] The impact of THO ... direct, and by the identification in yeast THO mutants ofa larger nuclear macromolecular structure containing components ofthe nuclear pore complex and poly adenylation factors [10] Function of...
... in the treatment of SARS remain unanswered, including the efficacy of this treatment, the appropriate timing of initiation of treatment, andthe dose and duration of therapy Steroid therapy causes ... significant adverse effects, and this remains true in patients with SARS Wang and coworkers [12] described a case of fatal aspergillosis, and recent press reports indicate that a large number of SARS ... the basis ofthe pathophysiology of SARS The severe respiratory failure, which occurs in the later phase of SARS and results in critical illness, appears to be due to an excessive inflammatory...
... Ministry of Employment, the Ministry of Social Affairs andthe Ministry of Education DWECS was conducted in 1990, and featured a random sample drawn from the Central Population Register of Denmark of ... used to analyse the associations between the risk factors andthe outcome variable The analysis was performed in three stages: initially, analysis was performed to establish the association between ... considerably younger than the official retirement age, and to ensure a maximum age of 59 during follow-up: Alternative labour market exit options in terms of voluntary early retirement is available...
... patient-controlled analgesia pumps The OAAI ignores clinical activities other than epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal ... general anesthesia Maternal death due to anesthesia is the sixth leading cause of pregnancyrelated death in theUnitedStates [6] and most anesthesia-related deaths occur during general anesthesia ... (1) The ratio ofthe epidural and cesarean components ofthe OAAI (OAAI EPI and OAAI CD) was also calculated as follows: OAAICD/EPI = ( no of cesareans per yr *1.5 ) / ( no of epidurals per...
... Identification ofthe primary cause of respiratory distress is vital for the initiation of appropriate therapy Active pulmonary TB is a rare primary cause of ARF and is associated with very high mortality ... hospital stay was 111 days DISCUSSION Identification ofthe primary cause of respiratory distress is vital for the initiation of appropriate therapy Active pulmonary TB is a rare primary cause of ARF ... Gradually in weeks he was able to maintain 90% oxygen saturation (SaO2) at room air Anti-tuberculosis therapy was continued and at 12 weeks he was maintaining oxygen saturation (SaO2) of 94% at...
... only ofa transient nature Our data suggest a sequential model of signaling in which CD95 receptor activation generates early signals at the plasma membrane that lead to the translocation of nuclear ... 30 (A) and h (B), respectively (A) The remaining surface CD95 was detected by FACS analysis, andthe percentage of CD95 downregulation was calculated for the GFP+ and GFP) populations (B) Apoptosis ... investigation What is the biological function of nuclear FADD and its nuclear–cytoplasmic translocation? Functional DISC assembly and activation of caspase-8 is generally considered to be a ‘point of...