a series of stretches for hands wrists and forearms
A park like transformation for the study and the control of a nonsinusoidal brushless DC motor
... on a coordinate transformation and an input transformation as well But the main advantage of the Park transformation is to define an internal state variable which is physically meaningful : that ... permanent magnets of the rotor : where L, and M, are the self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation, L, and M, are constant ara arb ... motor has the following typical features : - The airgap length is constant and large since the magnets are surface mounted and have the same permeability as air As a result, the armature reaction...
- 8
- 517
- 1
Tài liệu A History of England for Boys and Girls pdf
... have won, and ever since the days of Alfred, England has had a navy and Britannia has ruled the waves "Ye mariners of England That guard our native seas, Whose flag had braved a thousand years ... herself and them, rather than that they should fall again into the hands of the Romans CHAPTER 15 CHAPTER THE LAST OF THE ROMANS CARACTACUS was dead, Boadicea was dead, many other brave British leaders ... into a lonely part of Wales There he built a strong castle in which to hide, for he was very much afraid He was afraid of Hengist and the Saxons, and he was afraid of the Britons He was also afraid...
- 285
- 627
- 0
A MANUAL OF PRONUNCIATION FOR PRACTICAL USE IN SCHOOLS AND FAMILIES CONTAINING A CAREFUL SELECTION pdf
... known, and the correction of such faults in adult life is a matter of considerable care and effort This manual has been prepared for practical use in the school-room and for the use of families and ... ultimate standard of pronunciation for the English language is the usage that prevails among the best-educated portion of the people to whom the language is vernacular; or, at least, the usage that ... PREFACE Nothing so quickly or so certainly reveals the character of our culture and early associations as our speech The persistence of habits formed in youth, especially bad habits of pronunciation,...
- 156
- 470
- 0
Báo cáo khoa học: "A GENERATIVE GRAMMAR APPROACH FOR THE MORPHOLOGIC AND MORPHOSYNTACTIC ANALYSIS OF ITALIAN" ppt
... This grammar can both generate from a given lemma all the current Italian words deriving from it and analyze a given word by 33 lemma I stem matte mattino di andare andare matt mattin di vad and ... U.Bortolini, C.Tagliavini and A. Zampolli, Lessico di freq.enza delia lingua italiana contemporanea, ed IBM, 1971 161 B.Bottini and M.Cappelli, Un Meta Analizzatore Orienial al Linguaggio Natnrale in Ambiente ... three attributes: endinLda.~ in The other sets of data are contained in the Prolog workspace and are structured as tables of a relational data base l the morphologic and semantic characteristics of...
- 6
- 378
- 0
Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf
... methods and analyzed with a microscope, BZ-8100 (Keyence, Osaka, Japan) Acknowledgements We greatly appreciate Dr Masatoshi Maki and Dr Hideki Shibata in our laboratory for providing valuable suggestions ... recombinant human TGases 1, -2 and -3 and purified guinea-pig liver TGase were purchased from Zedira (Darmstadt, Germany) and Sigma (St Louis, MO, USA) For the activation of TGase 3, the zymogen was ... [25,26] Although several studies have focused on the localization, structural analysis and activation mechanism of TGase zymogen, not much information is available about the substrate specificity and...
- 11
- 645
- 0
Title: A History of Art for BHistoric Doubts on the Life and Reign of King Richard the Thirdeginners and Students: Painting, Sculpture, Architecture Painting docx
... gentleman of fame and family, says lord Bacon What can be said against king James of Scotland, who bestowed a lady of his own blood in marriage on Perkin? At war with Henry, James would naturally ... probable, than that the king's own brothers should have dipped their hands in so foul an assassination? Richard, in particular, is allowed on all hands to have been a brave and martial prince: he had ... singular bravery and address, and with all the arts of a politician and the cruelty of a conqueror Indeed on neither side there seem to have been any scruples: Yorkists and Lancastrians, Edward and...
- 50
- 543
- 0
Title: A History of Art for Beginners and Students: Painting, Sculpture, Architecture Painting doc
... statues of the hero-god For example, he made a statue of "Alexander with his Spear," "Alexander at a Lion Hunt," "Alexander as the Sun-God," and so on through many changes of expression and attributes, ... for the artists of all time This figure of Theseus is wonderful for the majesty and grace of its attitude, for perfection of its anatomical accuracy, and for the appearance of elasticity of muscle ... praises sung and said of him, and Lucian, who knew all the best works of all the greatest masters of Greece, puts Calamis before them all for elegance and grace, and for the finer expression of...
- 154
- 406
- 0
Designing a supply chain Proposition for improving quality and overall productivity of enterprises using business model
... in table 2.1) based on its operations and activities and two sections financial and non-financial and are explained as follows: 2.8.1 Strategic Strategic level performance measures are the measures ... segments of 11 customers and the architecture of the firm and its network of partners for creating, marketing and delivering this value and relationship capital, in order to generate profitable and ... are highest in this strategy if the company fails to forecast the demands accurately A comparison chart of logistical, manufacturing, and product characteristics against the supply chain strategies...
- 113
- 353
- 0
Báo cáo hóa học: " A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses" pdf
... Virology Journal 2008, 5:135 http://www.virologyj.com/content/5/1/135 (A) A T A A T T T A A T C (B) G C C G G/GATCCAAGCGGTCATCCGTATAATATTACCGGATGGCCGC/GGCCGCAAAAGAGCT/C C G BamHI NotI SacI T A A T C ... Sequencing of TYLCV cloned sequences pGreen1589 (+) pG1825(-) 579 (+) 1141 (+) 1741(+) 2321(+) CACGACGTTGTAAAACGACG CACAGGAAACAGCTATGACC GATGTTACTCGTGGATCTGG CATGATCAACTGCTCTGATTAC GGGCTTCCCGTACTTTGTG ... youngest part of a tomato plant 36 days after agroinoculation with p1.01TYLC Total DNA was extracted with the Midi DNeasy plant DNA extraction kit (Qiagen) DNA Page of 10 (page number not for citation...
- 10
- 396
- 0
báo cáo hóa học: " In vitro and in vivo pre-clinical analysis of a F(ab’)2 fragment of panitumumab for molecular imaging and therapy of HER1-positive cancers" pot
... panitumumab F(ab’) fragment with an emphasis on its evaluation towards both imaging and therapeutic applications Materials and methods Preparation of F(ab’)2 fragments Panitumumab (Amgen) was ... M, et al: Cetuximab: Preclinical Evaluation of a Monoclonal Antibody Targeting EGFR for Radioimmunodiagnostic and Radioimmunotherapeutic Applications Cancer Biotherapy and Radiopharmaceuticals ... Figure SDS-PAGE analysis of panitumumab F(ab’)2 The panitumumab F(ab’)2 was evaluated by SDS-PAGE before (a) and after (b) the final step of buffer exchange and concentration using a Centriprep...
- 15
- 452
- 0
Báo cáo hóa học: " Research Article Hierarchical Convergence of a Double-Net Algorithm for Equilibrium Problems and Variational Inequality Problems" ppt
... Fix T such that Ax, x − x ≥ 0, ∀x ∈ Fix T , 1.7 a variational inequality studied by Yamada and Ogura 10 A Example 1.3 Let A be a maximal monotone operator Taking T Jλ : I A −1 and P I − γ∇ψ, ... Muglia, and Y Yao, “On a two-step algorithm for hierarchical fixed point problems and variational inequalities,” Journal of Inequalities and Applications, vol 2009, Article ID 208692, 13 pages, ... Yamada and Ogura 10 , mathematical program studied by Luo et al 11 , hierarchical minimization problem considered by Cabot 12 and Solodov 13 , as special cases For solving 1.12 , we propose a...
- 16
- 313
- 0
Báo cáo hóa học: "Research Article Weighted Estimates of a Measure of Noncompactness for Maximal and Potential Operators" pot
... Journal of Inequalities and Applications see, e.g., 18 and for fractional maximal functions and Riesz potentials by Muckenhoupt and Wheeden 19 Two-weight criteria for the Hardy-Littlewood maximal ... 34, page that the measure of noncompactness of T is greater than or equal to limn → ∞ en T In the sequel, we assume that X is a Banach space which is a certain subset of all Haarmeasurable functions ... Journal of Inequalities and Applications, vol 7, no 4, pp 555–591, 2002 27 D R Adams, A trace inequality for generalized potentials,” Studia Mathematica, vol 48, pp 99–105, 1973 28 V G Maz’ya and...
- 19
- 210
- 0
Báo cáo hóa học: "Design of Experiments for Performance Evaluation and Parameter Tuning of a Road Image Processing Chain" ppt
... vehicle CAN bus As the first tests performed by the industrial car part supplier FAURECIA demonstrated that a static tuning is ineffective against road image variability, an automatic and adaptive ... from a video sequence of over 30 000 city and motorway frames A statistical model has been deduced and validated by measuring R-Square and Mallow C(p) indicator (Table 3) High R-Square and low ... Lucas, A Domingues, D Driouchi, and P March´ , “Modele ing, evaluation and control of a road image processing chain,” in Proceedings of the 14th Scandinavian Conference on Image Analysis (SCIA...
- 10
- 460
- 0
design and optimization of thermal systems A Series of Textbooks and Reference Books Founding ppt
... Charles A Schacht 179 Practical Engineering Failure Analysis, Hani M Tawancy, Anwar Ul-Hamid, and Nureddin M Abbas 180 Mechanical Alloying and Milling, C Suryanarayana 181 Mechanical Vibration: Analysis, ... 194 Damage Mechanics, George Z Voyiadjis and Peter I Kattan 195 Standard Handbook of Chains: Chains for Power Transmission and Material Handling, Second Edition, American Chain Association and ... Gears and Their Vibration: A Basic Approach to Understanding Gear Noise, J Derek Smith Chains for Power Transmission and Material Handling: Design and Applications Handbook, American Chain Association...
- 753
- 453
- 0
A framework of knowledge management systems issues and challenges for theory and practice
... the domain, they may not have an accurate first-hand understanding of the content Hence, the keywords and meta-data tags appended by the knowledge librarian may be inappropriate and as a result ... knowledge as “fluid mix of framed experience, values, contextual information and expert insight that provide a framework for evaluation and incorporating new experiences and information” (Davenport and ... traditional approaches to systems development, such as those adopted for organizational databases for instance, may not be appropriate For example, with traditional systems, the domain data is...
- 11
- 369
- 0
.Roll Forming Handbook.MANUFACTURING ENGINEERING AND MATERIALS PROCESSING A Series of Reference pps
... (hand) and factura (making) When flatrolled sheets became commercially available, for a long time, the final products were manufactured, formed, and shaped by hand Gradually, machines, particularly ... CCC, a separate system of payment has been arranged Trademark Notice: Product or corporate names may be trademarks or registered trademarks, and are used only for identification and explanation ... Canadian Steel Pipe Institute, and the Canadian Standards Association Metric Committee He is a member of several professional associations and is a registered consulting engineer He authored approximately...
- 583
- 686
- 9
Báo cáo y học: "PTPN22 polymorphism and anti-cyclic citrullinated peptide antibodies in combination strongly predicts future onset of rheumatoid arthritis and has a specificity of 100% for the disease" ppsx
... was 5'-CAACTGCTCCAAGGATAGATGATGA-3 'and the reverse primer was5'-CCAGCTTCCTCAACCACAATAAATG-3' The probes were labelled at their 5' ends with FAM™ (the C allele) and VIC™ (the T allele) and the ... 1858T variant and a disease related autoantibody, and that they co-operate to increase the relative risk of developing an autoimmune disease, in this case RA Our data suggest that carriage of the ... carriage of the T variant and there was a greatly increased relative risk for the development of RA Available online http://arthritis-research.com/content/8/1/R19 in individuals with a combination...
- 6
- 322
- 0
Báo cáo y học: "Left ventricular diastolic dysfunction of the cardiac surgery patient; a point of view for the cardiac surgeon and cardio-anesthesiologist" pptx
... dysfunction and diastolic heart failure: Part II: Causal mechanisms and treatment Circulation 2002, 105:1503-8 Angeja B, Grossman W: Evaluation and management of diastolic heart failure Circulation 2003, ... coronary artery bypass grafting, showed that DD was characterized by a decrease in E wave velocity, prolongation of the E wave DT, and a decrease of E /A ratio [43] Potential implicated mechanisms ... of left ventricle can be intraoperatively diagnosed, estimated and graded by using Trans Oesophageal Echo (TOE) Moreover, valuable information may be obtained with the additional use of a Swan-Ganz...
- 10
- 490
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008