0

a schematic diagram of the level of complexity from genome to the proteome

Expression dynamics of the hepatic mitochondrial proteome of the sod2+  mouse in response to troglitazone administration

Expression dynamics of the hepatic mitochondrial proteome of the sod2+ mouse in response to troglitazone administration

Tổng hợp

... 8-oxo-hydrodeoxyguanosine Alanine aminotransferase Asparate aminotransferase Area under curve Carbonate radical anion Chromatin Immunoprecipitation Database for Annotation, Visualization and Integrated Discovery ... applications (Azad et al., 2006, Diamond et al., 2006, Hanash, 2003) 32 Figure 10 A schematic diagram of the level of complexity from genome to the proteome The increase in complexity of biological molecules ... label-free mass-spectrometry-based proteomics and (iii) and protein-chipbased arrays There are advantages and disadvantages to both platforms and they are listed in Table Due to the numerous facets of...
  • 226
  • 1,830
  • 0
phrasal verbs followed by the -ing form

phrasal verbs followed by the -ing form

Ngữ pháp tiếng Anh

... without a hitch (a hitch is a problem), it happens as planned The drug bust went off without a hitch The invasion didn't go off the way the general planned it go off p.v When a road, trail, path, and ... verbs from this section Be sure the phrasal verbs are in the correct tense You're going to spend the day on the sofa watching TV What are you going to all day? Lydia walked to various places in ... go around p.v When people or things follow a circular path and return to the same place, they go around The horse has gone around the track three times It took seven days to go around the island...
  • 16
  • 741
  • 0
Báo cáo y học:

Báo cáo y học: " Enteritis caused by Campylobacter jejuni followed by acute motor axonal neuropathy: a case report" pptx

Báo cáo khoa học

... O:19 According to our knowledge, this is the first report of AMAN associated with C jejuni in the Balkan region Case presentation A 46-year-old Caucasian man, a physician from a town in central ... Disease Program, National Microbiology Laboratory, Winnipeg, Manitoba, Canada A strain presumptively identified as Campylobacter was differentiated to the species level by a combination of biotyping ... Institute of Public Health, Dr Suboti a 5, 11000 Belgrade, Serbia 4National Laboratory for Enteric Pathogens, National Microbiology Laboratory, The Canadian Science Centre for Human and Animal Health,...
  • 4
  • 351
  • 0
40185 prepositional verbs followed by the gerund

40185 prepositional verbs followed by the gerund

Anh ngữ cho trẻ em

... what you wanted to Writers cannot rely their (share) _ a common context to interpret the other's casual, compact or cryptic speech If you usually keep your windows/doors open, then count ... If you usually keep your windows/doors open, then count (change) the air filter every month We all agree _ your (open) _ the discussion ...
  • 2
  • 317
  • 0
Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

Báo cáo khoa học

... controls; the values presented represent an average of the plateau region for each leaflet of the bilayer From these data, it can be seen that, overall, the )SCD values in the top leaflet of the Ab40-DPPC ... comparable to that of the relevant control (NS1), based on the average order parameter of Tier in the two leaflets We thus conclude from these data that Ab interacts with the membrane in a Table Average ... averages of the data are shown, using a window of ten data points designation In the case of simulation A1 , the area per lipid headgroup is largely constant at the outset of the ˚ simulation, fluctuating...
  • 16
  • 475
  • 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Báo cáo khoa học

... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... residues Further analysis of these and other mutant SODs is currently underway ACKNOWLEDGEMENTS We are indebted to G Peplow, F Yamakura and T Matsumoto for the analyses of iron and manganese in ... glutamine to the active site location of the iron enzyme (Fe [A1 41Q]) has a very similar effect to removal of the existing glutamine and SOD activities are reasonably similar between the two mutants...
  • 12
  • 740
  • 0
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Báo cáo khoa học

... CCAAATT-3¢ and 5¢-AATTTGGGCGCGGGCCGCGA AAGTAACCGGAAT-3¢ for E19 0A, 5¢-CAAATTGGGGG CCCAGCAGCTGGGAAGTCTGAA-3¢ and 5¢-TTCAGA CTTCCCAGCTGCTGGGCCCCCAATTTG-3¢ for E19 9A, and 5¢-GAAGCTGGGAAGTCTGCACAGTCTGGAGCC ... corresponding to a calculated average molecular mass of approximately 53 kDa smaller than wild-type Hsp25, and to an average oligomer of 24–25 subunits Thus, with the exception of the E19 0A mutant, the ... (mass of 443 kDa) (Fig 4), with an average molecular mass of 613 ± 185 kDa, as calculated from the standard curve (not shown), corresponding to an average oligomer of Glutamic acid mutants of...
  • 14
  • 417
  • 0
Báo cáo khoa học: Phosphorylation of the Saccharomyces cerevisiae Grx4p glutaredoxin by the Bud32p kinase unveils a novel signaling pathway involving Sch9p, a yeast member of the Akt / PKB subfamily pot

Báo cáo khoa học: Phosphorylation of the Saccharomyces cerevisiae Grx4p glutaredoxin by the Bud32p kinase unveils a novel signaling pathway involving Sch9p, a yeast member of the Akt / PKB subfamily pot

Báo cáo khoa học

... for the endogenous kinase in the association with Grx4p, whereas a similar amount of the S25 8A mutant (lane 3) failed to bind Grx4p, as shown by a signal comparable to the background level (lane ... activate the GAL regulon Total mRNAs were extracted and subjected to standard northern blot analysis GAL1 mRNA, and ACT1 mRNA (considered as a loading control), were detected by the use of specific radiolabeled ... cellular lysate in which Sch9p was HA-tagged The results shown in Fig 7A indicate that the two proteins are able to interact In fact, a western blot analysis revealed the presence of Sch9p associated...
  • 15
  • 414
  • 0
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

Báo cáo khoa học

... corresponding to the mature peptide of MeMIH-B was amplified by PCR using T7 promoter-linked primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3¢) ... of the eyestalk (open bar) and thoracic ganglia (diagonally shaded bars) of females The percentage indicates the GSI of the females M (B) indicates the expression pattern of MIH-B in the same ... sample from the eyestalk or the thoracic ganglion of one shrimp The last lane shows the RNA samples from a male The bar indicates the SE with 0.3 nm rMeMIH-B, an increase of about 25% of MeVg1...
  • 11
  • 546
  • 0
Báo cáo khoa học: Variants of b2-microglobulin cleaved at lysine-58 retain the main conformational features of the native protein but are more conformationally heterogeneous and unstable at physiological temperature potx

Báo cáo khoa học: Variants of b2-microglobulin cleaved at lysine-58 retain the main conformational features of the native protein but are more conformationally heterogeneous and unstable at physiological temperature potx

Báo cáo khoa học

... capillary cooling fluid maintained at 278 K Samples also contained 0.2 mgÆmL)1 of a marker peptide Shown are the summed peak areas P (total area of f + s peaks) divided by the marker peak area M at ... characterization of the conformational states of the cK58-b2m and dK58-b2m variants has now been accomplished, and has made it possible, by reference to the NMR pattern of the DN3 variant of b2m, to identify ... similar to that of the wt protein In fact, distinct differences in the conformation of the variants are confined to the cleavage site region (the D–E loop) with additional involvement of the adjacent...
  • 14
  • 358
  • 0
Báo cáo khoa học: The phosphatidylethanolamine level of yeast mitochondria is affected by the mitochondrial components Oxa1p and Yme1p ppt

Báo cáo khoa học: The phosphatidylethanolamine level of yeast mitochondria is affected by the mitochondrial components Oxa1p and Yme1p ppt

Báo cáo khoa học

... CAGGTATGTGGTTCCAAGTGTTTGTCGCTCTTTGAATTTGGAATTCGAGCTCGTTTAAAC TCTAATACGACTCACTATAGGGAGAATGTCAATTATGCCAGTTAAG CTTTACATATGATTGCTTTCATTTTAAATCATTCTTTCC AGAACTGCGGTGCTATGGAATAGA TTTGGCACGATCCACAATCTC an overnight culture and cells ... GTTCACGTACAAGCGGAGCCACAGAATAACCTCCCCGACGCGGATCCCCGGGTTAATTAA GTTTTATATTTTTATATTTACAGAGAGATATAGAGCCTTTATGAATTCGAGCTCGTTTAAAC GCCAGTTAAGAACGCCTTGGCGCAAGGGAGGACGCTCCTCCGGATCCCCGGGTTAATTAA CAGGTATGTGGTTCCAAGTGTTTGTCGCTCTTTGAATTTGGAATTCGAGCTCGTTTAAAC ... space sorting signal, yielding the second intermediate of 50 kDa Assembly of Psd1p into the IMM was completed by (autocatalytic) cleavage of the 50 kDa intermediate to one a- chain and one b-chain...
  • 11
  • 354
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

Báo cáo khoa học

... indirect-gap materials Values of the optical band gap for the samples were obtained by the extrapolation of the linear region of the plot of (ahv)1/2 against photon energy (hv) as shown in Fig 4(c) Clearly, ... approach to band gap calculation is not particularly accurate for polydisperse solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band ... portion of anhydrous acetone was added to the product solution After 145 acetone treatment, a flocculate is obtained due to insolubility of SnS NCs in the short chain ketone and then separated by...
  • 5
  • 365
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" ppt

Báo cáo khoa học

... indirect-gap materials Values of the optical band gap for the samples were obtained by the extrapolation of the linear region of the plot of (ahv)1/2 against photon energy (hv) as shown in Fig 4(c) Clearly, ... approach to band gap calculation is not particularly accurate for polydisperse solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band ... portion of anhydrous acetone was added to the product solution After 145 acetone treatment, a flocculate is obtained due to insolubility of SnS NCs in the short chain ketone and then separated by...
  • 5
  • 276
  • 0
Báo cáo y học:

Báo cáo y học: "Diabetic ketoacidosis complicated by the use of ecstasy: a case report" ppsx

Báo cáo khoa học

... rate and arterial blood pressure); exacerbation of anxiety; and activation Page of of the hypothalamic-pituitary-adrenal axis The most frequently reported side effects are arrhythmias, hyperthermia, ... reveal bacteria; arterial blood gas measurement revealed clinically important metabolic acidosis (Table 1); and lactate was in the normal reference range The patient received immediate intravenous ... classified as a hallucinogenic amphetamine [6] The drug acts primarily by promoting a massive release of serotonin from the presynaptic cleft and, additionally, inhibits serotonin reuptake and...
  • 3
  • 399
  • 0
Báo cáo y học:

Báo cáo y học: "Diabetic ketoacidosis complicated by the use of ecstasy: a case report." docx

Báo cáo khoa học

... rate and arterial blood pressure); exacerbation of anxiety; and activation Page of of the hypothalamic-pituitary-adrenal axis The most frequently reported side effects are arrhythmias, hyperthermia, ... reveal bacteria; arterial blood gas measurement revealed clinically important metabolic acidosis (Table 1); and lactate was in the normal reference range The patient received immediate intravenous ... classified as a hallucinogenic amphetamine [6] The drug acts primarily by promoting a massive release of serotonin from the presynaptic cleft and, additionally, inhibits serotonin reuptake and...
  • 3
  • 327
  • 0
Báo cáo y học:

Báo cáo y học: "Inhibition of NFκB by the natural product Withaferin A in cellular models of Cystic Fibrosis inflammation" pps

Báo cáo khoa học

... site of infection and these cells release proteases and other agents that cause structural damage to the airways Anti-inflammatory agents are used to manage lung inflammation in CF, but have adverse ... us to Withaferin A (WFA), a steroidal lactone isolated from the herb Withania somnifera (also known as Indian Ginseng and Ashwagandha), which is widely used in traditional Indian medicine as an ... complementary and alternative approaches to supplement conventional therapies [23] We are intrigued by this finding, as there are many promising anti-inflammatory and anti-bacterial ethnopharmacological...
  • 5
  • 306
  • 0
A study on the structure of the speech “ I have a dream” by Martin Luther King A systemic functional grammar analysis

A study on the structure of the speech “ I have a dream” by Martin Luther King A systemic functional grammar analysis

Tổng hợp

... analysis based on Halliday’s functional grammar as the theoretical framework 1.2 Aims of the study In carrying out the research, the writer aims to:  Illustrate the key concepts in FG  Analyze the ... language teaching and learning becomes Hence, I decided to conduct a study on the structure and meaning of the speech “I have a dream” by Martin Luther King - a systemic functional grammar analysis ... Functionalists, on the other hand, hold the belief that “Grammar should be seen as facilitating communication in all modes, not as an isolated area of study” (G Lock, 1996) As having the experience of...
  • 4
  • 676
  • 5
Tài liệu Protein Data Bank Contents Guide: Atomic Coordinate Entry Format Description Version 3.20 Document Published by the wwPDB ppt

Tài liệu Protein Data Bank Contents Guide: Atomic Coordinate Entry Format Description Version 3.20 Document Published by the wwPDB ppt

Ngân hàng - Tín dụng

... PDB entries CAVEAT Optional Mandatory when there are outstanding errors such as chirality COMPND Mandatory SOURCE Mandatory KEYWDS Mandatory EXPDTA Mandatory NUMMDL Optional Mandatory for NMR ... Optional Mandatory for a publication describes the experiment REMARK Optional Mandatory for a re-refined structure REMARK Optional REMARK Mandatory REMARK Mandatory REMARK N Optional Mandatory ... Optional Mandatory if a non-standard group other than water appears in the coordinates HETNAM Optional Mandatory if a non-standard group other than water appears in the coordinates HETSYN Optional FORMUL...
  • 205
  • 387
  • 0
Tài liệu Báo cáo khoa học: Mitochondrial chaperone tumour necrosis factor receptor-associated protein 1 protects cardiomyocytes from hypoxic injury by regulating mitochondrial permeability transition pore opening docx

Tài liệu Báo cáo khoa học: Mitochondrial chaperone tumour necrosis factor receptor-associated protein 1 protects cardiomyocytes from hypoxic injury by regulating mitochondrial permeability transition pore opening docx

Báo cáo khoa học

... vector for silencing of TRAP1 expression (TRAP1-siRNA) was purchased from Shanghai GeneChem, Co Ltd The targeting sequence of the siRNA against rat TRAP1 was 5¢-CAACAGAGATTGATCAA AT-3¢ A negative ... opens, apoptogenic substrates (i.e cytochrome c) are released into the cytoplasm and activate caspase-dependent apoptotic pathways Because MPTP plays a critical role in cell necrosis and apoptosis, ... 14 Masuda Y, Shima G, Aiuchi T, Horie M, Hori K, Nakajo S, Kajimoto S, Shibayama-Imazu T & Nakaya K (2004) Involvement of tumor necrosis factor receptor-associated protein (TRAP1) in apoptosis...
  • 10
  • 507
  • 0
Tài liệu Báo cáo khoa học: Regulators of G-protein signalling are modulated by bacterial lipopeptides and lipopolysaccharide pptx

Tài liệu Báo cáo khoa học: Regulators of G-protein signalling are modulated by bacterial lipopeptides and lipopolysaccharide pptx

Báo cáo khoa học

... release of different inflammatory mediators Stimulation of TLR leads to activation of a series of signalling proteins, and to the expression of pro- and inflammatory cytokines There is evidence that ... 5¢-GACCCTCACACTCAGATCATCTTC-3¢ (sense), 5¢-CC ACTTGGTTTGCTACGA-3¢ (antisense) Acknowledgements We appreciate the excellent technical assistance of Suhad Al-Badri and Franziska Daduna We thank Roland Lang and ... involvement of MyD88 (Fig 6) We suggest that the inflammatory and the adjuvant activities of TLR-ligands are at least partially mediated through modulation of RGS1 and RGS2 The molecular mechanisms, leading...
  • 11
  • 569
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25