... bands of local variation in the spatial density of crystals, presumably due to the interaction between the rate of advance of Ag+ and the rate of sequestration of chromate into nascent crystals ... Reconstruction ofthe collateral branches ofthe axon ofa Purkinje cell, including the parent axon, soma and a small part ofthe dendritic tree Scale bar = 50 µm B, C: Terminal axonal arborescences of Purkinje ... primer 2A: 5’ TTTCTGCTCGAATTCAAGCTTCTAACGATGTACGGGGACATG 3’ – primer 2B: 5’ TCCCCGTACATCGTTAGAAGCTTGAATTCGAGC [amino mod C7] 3’ – primer SAGE (biotinylated): 5’ [biotin] GGATTTGCTGGTGCAGTACA 3’...
... cultured samples) NA8F-M13 5'-GTA AAA CGA CGG CCA GT GRA CHC ARG ART CIK MRTG-3'- and NA10R-M13 5'-CAG GAA ACA GCT ATG AC CCI IKC CAR TTR TCY CTR CA-3' or NA8F 5'-GRA CHC ARG ART CIK MRTG-3' and NA10R ... representation of 3,337 available sequences in the NCBI database at the time the study was conducted All NA subtypes were aligned against the NA10R primer and analyzed for discrepancies at the 3'end The ... repeat the assay because our RNA stock of those samples was exhausted The fact that there was no virus isolated for those samples does not necessarily explain the lack of amplification, as we...
... begins with a C and PCR amplification will change this codon from CAA to GAA (and the second residue in the recombinant protein will be glutamate instead of glutamine) An alternative strategy which ... result in the amplification ofthe original coaD gene The use ofthe Nco I restriction site dictates what thefirst nucleotide ofthe next triplet codon must be (G) In the coaD gene, however, the second ... PPAT) CG GGATCCCTA CGCTAACTTCGCCATCAGC 5' extension (CG) BamH I restriction site (GGATCC) Complement of stop codon (CTA) Overlap with the strand complement to the 3'-end ofthe coaD gene Estimated...
... cDNAs synthesis NBAAAAAAA NVTTTTTTT UP-I NBAAAAAAA NVTTTTTTT 16 The 2nd PCR PLR UP-II GGATCC GGG CCC NBAAAAAAA NVTTTTTTT cDNA library NBAAAAAAA NVTTTTTTT 16 16 UP-II Fig Detailed mechanism ofthe ... with the use of Takara Ex Taq Hot Start Version (TaKaRa), with the primary library sequences serving as the template Briefly, PLF (5¢-AAGCAGTGGTATCAACGCA GAGT-3¢) was used as the sense primer, and ... NBAAAAAAA NVTTTTTTT 16 16 Modified oligo (dT) 5′-cap oligo 5′ GGG CCC PLF mRNA Tag-specific primer NBAAAAAAA-3′ NVTTTTTTT 16 Modified oligo (dT) GGATCC 16 The 1st PCR GGATCC GGG CCC NBAAAAAAA...
... quasilinear phase, and finally reach a plateau The plateau effect (82,83) is the result ofa marked shift ofthe overall mass balance in favor ofthe reaction product A complex of features seems ... sample may differ depending on the kind of biological sample matrices If componentsofthe sample matrix have the same density as the cells these may inhibit DNA amplification The advantage of density ... for the attainment ofthe plateau rather than a single factor or parameter, as readdition of presumably exhausted reagents (dNTPs, primers, DNA polymerase, MgCl2) at late cycles did not cause the...
... ofthe assay to detect changes in the expression of genes of interest and may also produce artificial changes [3] Traditionally glyceraldehyde 3phosphate dehydrogenase (GAPDH) and β-actin (BACT) ... high-impact journals found that GAPDH, BACT, 18sRNA and 28sRNA were used as a single control gene in >90% of cases [13] However, we found that two of these (18sRNA and BACT) were the least reliable ... experiments was extracted using the RNAqueous-Midi kit (Ambion, TA), quantified by UV spectroscopy and the integrity confirmed using an agilent 2100 bioanalyzer μg ofthe total RNA was then DNase treated...
... ofthe reactions revealed a mixture of G and A at position 1270 and the four other traces clearly indicated that G was dominant at this position; this base was manually identified as G Accuracy ... plasma/serum samples including guanidine thiocyanate denaturation plus phenol/chloroform extraction, the ZR Viral RNA Kit (ZYMO Research) and the QIAamp Viral RNA Mini Kit (Qiagen) The QIAamp Viral RNA Mini ... template due to the limited amount of patient plasma or serum that is often available and the relatively low titer ofthe virus We tried three RNA isolation protocols to isolate RNA from plasma/serum...
... ofthe assay to detect changes in the expression of genes of interest and may also produce artificial changes [3] Traditionally glyceraldehyde 3phosphate dehydrogenase (GAPDH) and β-actin (BACT) ... high-impact journals found that GAPDH, BACT, 18sRNA and 28sRNA were used as a single control gene in >90% of cases [13] However, we found that two of these (18sRNA and BACT) were the least reliable ... experiments was extracted using the RNAqueous-Midi kit (Ambion, TA), quantified by UV spectroscopy and the integrity confirmed using an agilent 2100 bioanalyzer μg ofthe total RNA was then DNase treated...
... ofthe reactions revealed a mixture of G and A at position 1270 and the four other traces clearly indicated that G was dominant at this position; this base was manually identified as G Accuracy ... plasma/serum samples including guanidine thiocyanate denaturation plus phenol/chloroform extraction, the ZR Viral RNA Kit (ZYMO Research) and the QIAamp Viral RNA Mini Kit (Qiagen) The QIAamp Viral RNA Mini ... template due to the limited amount of patient plasma or serum that is often available and the relatively low titer ofthe virus We tried three RNA isolation protocols to isolate RNA from plasma/serum...
... injections of 100 μl of collagen/adjuvant were made, one into the base ofthe tail and the other further up the back, separated by approximately 1.5 cm A boost injection ofthe same material was given ... phalangeal joints as well as inflammation, pannus formation, and bone damage, as indicated by histologic analysis [see Figure S2 in Additional data file 1] In vivo safety assays The observed amplification ... statistical analysis is by analysis of variance with Tukey HPA, hypothalamus-pituitary-adrenal prednisolone by modulation of intersecting signaling pathways that selectively amplify the anti-inflammatory...
... measured with Mop-Videoplan, an analytic system (Zeiss-Kontron), using standard software The surface/volume ratios ofthe different systems were calculated on the basis of an average pm diameter ... separately penetrating hyphae, a structure that can be observed after the death of cortical cells, when active absorption is restricted to theaThe intimate contact with the cell surface and the ... (1988) Ultrastructural localization of ATPase activity in the Pinus sylvestrisltaccaria laccata ectomycorrhizal association New P O8, 329-334 7yfo/ / an although The investigations have been supported...
... internal sites of inflammation, such as the synovium of an arthritic patient Reactivation of virus at these sites does not serve the purpose ofthe virus but may aggravate the disease process The ... can infect epithelial and endothelial cells Salivary glands are a major site of production of HHV7 [9,52] HHV6 and HHV7 antigenemia occurs in the setting of CMV reactivation in transplant patients ... Yarilin antigens such as keratin and IgG, the target of typical rheumatoid factors; and apoptosis-related proteins such as annexin V, calpastatin, vimentin and filaggrin [107–115] For the last two antigens,...
... actgaacctgaccgtacacatgccctcatctaatgtct Primers for human E-Cadherin ECADF8 cagaaagttttccaccaaag ECADZR actgaacctgaccgtacaaaatgtgagcaattctgctt Primers for human γ-catenin gCatF1 aacaagaacaaccccaagtt gCatZr actgaacctgaccgtacatagttacgcatgatctgcac ... α-catenin ACATENINF1 ACATENINZR caacccttgtaaacaccaat actgaacctgaccgtacaccttctccaagaaattctca Primers for human β-catenin BCATENINF8 agggattttctcagtccttc BCATENINZF actgaacctgaccgtacacatgccctcatctaatgtct ... mean background reading Statistical analysis The data obtained was analysed using the MINITAB 13.32 (Minitab Inc State College, PA, USA) programme Statistical significance was calculated using the...
... DNA fragments by streptavidin capture Non-phosporylated biotinylated Illumina adapters were prepared by annealing 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCxT and 5’-GATCGGAAGAGC GGTTCAGCAGGAATGCCGAG-3BioTEG ... samples, the average quantity of each amplicon in a given sample was divided by the mean average quantities ofthe 48% and 52% GC amplicons in the same sample Hence, all GC-bias plots meet at ... 5’-phosphorylation and 3’-single-dA extension ofthe resulting fragments, adapter ligation, size fractionation on an agarose gel and PCR amplification of adapter-ligated fragments Bias can potentially...
... follows: the external primers 1a 5’-GGTCACTAGTGACGCTTGTATGATGA-3’, 1b 5’-GATAGTCGCGGGTACAGGGGACTCT-3’; the internal primers 2a 5’-AAGTGAGTTCTGTCGGGTGCT-3’, 2b 5’-GTGACACCAGAGAATCAGA GGA-3’ After ... Clari MA, Remigia MJ, Furio S, Calabuig M, Tormo N, Navarro D: Quantification of DNA in plasma by an automated real-time PCR assay (cytomegalovirus PCR kit) for surveillance of active cytomegalovirus ... M, GallezHawkins GM, Myerson D, Zaia JA, Bowden RA: Plasma polymerase chain reaction for cytomegalovirus DNA after allogeneic marrow transplantation - comparison with polymerase chain reaction...
... vgfF: CGCTGCTATGATAATCAGATCATT vgfR: GATATGGTTGTGCCATAATTTTTAT vgfF2: ACACGGTGACTGTATCCA vgfR2: CTAATACAAGCATAATAC Reference Fonseca et al., 1998 This study OVB2LF1: TCCCTGAAGCCCTATTATTTTTGT OVB2LR1: ... Trindade et al., 2006 Trindade et al., 2007 Leite et al., 2005 Abrahão et al., upubl Data Abrahão et al., upubl Data Abrahão et al., upubl Data Abrahão et al., upubl Data Abrahão et al., upubl Data ... [21] In the nested step, a pair of internal OPV primers (vgfF2: ACACGGTGACTGTATCCA and vgfR2: CTAATACAAGCATAATAC) were designed from alignment ofthe vgf sequences of Brazilian VACV strains (Drumond...
... (GAS) dnaseB assay dnaseB forward primer TGA TTC CAA GAG CTG TCG TG dnaseB reverse primer TGG TGT AGC CAT TAG CTG TGT T IAC TGATTCCAAGAGCTGTCGTGatcaatataacaaacacttgcatatatatact tacgaaactaataactaaataatcaatataaatACACAGCTAATGGCTACACCA ... design and data collection and analysis DR and IM participated in the performance ofthe PCR assay and data analysis All authors contributed to the preparation ofthe manuscript All authors read and ... tacgaaactaataactaaataatcaatataaatACACAGCTAATGGCTACACCA Slinger et al Annals of Clinical Microbiology and Antimicrobials 2011, 10:33 http://www.ann-clinmicrob.com/content/10/1/33 then heated at 100°C...
... depending on the organism adaptation to this factor on the action of radiation I Characterization ofa Drosophila stock adapted to high temperature Genetika (USSR) 16, 115-122 Traverse KL, Pardue ML ... (Chad, Central Africa) that were subjected to artificial selection for increased heat tolerance (Tikhomirova and Belyatskaya, 1980) Flies ofthe T-32 strain are exceptional in that they can develop ... squashes prepared (Atherton and Gall, 1972) with minor modifications was In situ by standard procedure hybridization Polytene chromosomes of salivary glands of D larvae were prepared ac-osophila...