0

a scatterplot matrix of the first three principal components of the crabs

modern neuroscience research protocol

modern neuroscience research protocol

Sinh học

... bands of local variation in the spatial density of crystals, presumably due to the interaction between the rate of advance of Ag+ and the rate of sequestration of chromate into nascent crystals ... Reconstruction of the collateral branches of the axon of a Purkinje cell, including the parent axon, soma and a small part of the dendritic tree Scale bar = 50 µm B, C: Terminal axonal arborescences of Purkinje ... primer 2A: 5’ TTTCTGCTCGAATTCAAGCTTCTAACGATGTACGGGGACATG 3’ – primer 2B: 5’ TCCCCGTACATCGTTAGAAGCTTGAATTCGAGC [amino mod C7] 3’ – primer SAGE (biotinylated): 5’ [biotin] GGATTTGCTGGTGCAGTACA 3’...
  • 1,296
  • 1,121
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A broad spectrum, one-step reverse-transcription PCR amplification of the neuraminidase gene from multiple subtypes of influenza A virus" pdf

Hóa học - Dầu khí

... cultured samples) NA8F-M13 5'-GTA AAA CGA CGG CCA GT GRA CHC ARG ART CIK MRTG-3'- and NA10R-M13 5'-CAG GAA ACA GCT ATG AC CCI IKC CAR TTR TCY CTR CA-3' or NA8F 5'-GRA CHC ARG ART CIK MRTG-3' and NA10R ... representation of 3,337 available sequences in the NCBI database at the time the study was conducted All NA subtypes were aligned against the NA10R primer and analyzed for discrepancies at the 3'end The ... repeat the assay because our RNA stock of those samples was exhausted The fact that there was no virus isolated for those samples does not necessarily explain the lack of amplification, as we...
  • 11
  • 378
  • 0
Primer design for the PCR amplification of the coad gene

Primer design for the PCR amplification of the coad gene

Ngoại ngữ

... begins with a C and PCR amplification will change this codon from CAA to GAA (and the second residue in the recombinant protein will be glutamate instead of glutamine) An alternative strategy which ... result in the amplification of the original coaD gene The use of the Nco I restriction site dictates what the first nucleotide of the next triplet codon must be (G) In the coaD gene, however, the second ... PPAT) CG GGATCCCTA CGCTAACTTCGCCATCAGC 5' extension (CG) BamH I restriction site (GGATCC) Complement of stop codon (CTA) Overlap with the strand complement to the 3'-end of the coaD gene Estimated...
  • 2
  • 481
  • 0
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

Báo cáo khoa học

... CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG ... 5¢-Forward-3¢ 5¢-Reverse-3¢ CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT Average efficiency ± SD Template Optimal PCR conditions Cocktail PCR conditions DENV-1...
  • 12
  • 795
  • 0
Báo cáo khoa học: Semi-nested PCR analysis of unknown tags on serial analysis of gene expression potx

Báo cáo khoa học: Semi-nested PCR analysis of unknown tags on serial analysis of gene expression potx

Báo cáo khoa học

... cDNAs synthesis NBAAAAAAA NVTTTTTTT UP-I NBAAAAAAA NVTTTTTTT 16 The 2nd PCR PLR UP-II GGATCC GGG CCC NBAAAAAAA NVTTTTTTT cDNA library NBAAAAAAA NVTTTTTTT 16 16 UP-II Fig Detailed mechanism of the ... with the use of Takara Ex Taq Hot Start Version (TaKaRa), with the primary library sequences serving as the template Briefly, PLF (5¢-AAGCAGTGGTATCAACGCA GAGT-3¢) was used as the sense primer, and ... NBAAAAAAA NVTTTTTTT 16 16 Modified oligo (dT) 5′-cap oligo 5′ GGG CCC PLF mRNA Tag-specific primer NBAAAAAAA-3′ NVTTTTTTT 16 Modified oligo (dT) GGATCC 16 The 1st PCR GGATCC GGG CCC NBAAAAAAA...
  • 7
  • 529
  • 0
pcr detection of microbial pathogens

pcr detection of microbial pathogens

Sinh học

... quasilinear phase, and finally reach a plateau The plateau effect (82,83) is the result of a marked shift of the overall mass balance in favor of the reaction product A complex of features seems ... sample may differ depending on the kind of biological sample matrices If components of the sample matrix have the same density as the cells these may inhibit DNA amplification The advantage of density ... for the attainment of the plateau rather than a single factor or parameter, as readdition of presumably exhausted reagents (dNTPs, primers, DNA polymerase, MgCl2) at late cycles did not cause the...
  • 321
  • 274
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pdf

Hóa học - Dầu khí

... of the assay to detect changes in the expression of genes of interest and may also produce artificial changes [3] Traditionally glyceraldehyde 3phosphate dehydrogenase (GAPDH) and β-actin (BACT) ... high-impact journals found that GAPDH, BACT, 18sRNA and 28sRNA were used as a single control gene in >90% of cases [13] However, we found that two of these (18sRNA and BACT) were the least reliable ... experiments was extracted using the RNAqueous-Midi kit (Ambion, TA), quantified by UV spectroscopy and the integrity confirmed using an agilent 2100 bioanalyzer μg of the total RNA was then DNase treated...
  • 5
  • 481
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" potx

Điện - Điện tử

... of the reactions revealed a mixture of G and A at position 1270 and the four other traces clearly indicated that G was dominant at this position; this base was manually identified as G Accuracy ... plasma/serum samples including guanidine thiocyanate denaturation plus phenol/chloroform extraction, the ZR Viral RNA Kit (ZYMO Research) and the QIAamp Viral RNA Mini Kit (Qiagen) The QIAamp Viral RNA Mini ... template due to the limited amount of patient plasma or serum that is often available and the relatively low titer of the virus We tried three RNA isolation protocols to isolate RNA from plasma/serum...
  • 9
  • 444
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pot

Hóa học - Dầu khí

... of the assay to detect changes in the expression of genes of interest and may also produce artificial changes [3] Traditionally glyceraldehyde 3phosphate dehydrogenase (GAPDH) and β-actin (BACT) ... high-impact journals found that GAPDH, BACT, 18sRNA and 28sRNA were used as a single control gene in >90% of cases [13] However, we found that two of these (18sRNA and BACT) were the least reliable ... experiments was extracted using the RNAqueous-Midi kit (Ambion, TA), quantified by UV spectroscopy and the integrity confirmed using an agilent 2100 bioanalyzer μg of the total RNA was then DNase treated...
  • 5
  • 574
  • 0
báo cáo hóa học:

báo cáo hóa học:" A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" pdf

Hóa học - Dầu khí

... of the reactions revealed a mixture of G and A at position 1270 and the four other traces clearly indicated that G was dominant at this position; this base was manually identified as G Accuracy ... plasma/serum samples including guanidine thiocyanate denaturation plus phenol/chloroform extraction, the ZR Viral RNA Kit (ZYMO Research) and the QIAamp Viral RNA Mini Kit (Qiagen) The QIAamp Viral RNA Mini ... template due to the limited amount of patient plasma or serum that is often available and the relatively low titer of the virus We tried three RNA isolation protocols to isolate RNA from plasma/serum...
  • 9
  • 442
  • 0
Báo cáo y học:

Báo cáo y học: "Selective amplification of glucocorticoid anti-inflammatory activity through synergistic multi-target action of a combination drug" ppsx

Báo cáo khoa học

... injections of 100 μl of collagen/adjuvant were made, one into the base of the tail and the other further up the back, separated by approximately 1.5 cm A boost injection of the same material was given ... phalangeal joints as well as inflammation, pannus formation, and bone damage, as indicated by histologic analysis [see Figure S2 in Additional data file 1] In vivo safety assays The observed amplification ... statistical analysis is by analysis of variance with Tukey HPA, hypothalamus-pituitary-adrenal prednisolone by modulation of intersecting signaling pathways that selectively amplify the anti-inflammatory...
  • 14
  • 326
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Amplification of root—fungus interface in ectomycorrhizae by Hartig net architecture" pot

Báo cáo khoa học

... measured with Mop-Videoplan, an analytic system (Zeiss-Kontron), using standard software The surface/volume ratios of the different systems were calculated on the basis of an average pm diameter ... separately penetrating hyphae, a structure that can be observed after the death of cortical cells, when active absorption is restricted to the a The intimate contact with the cell surface and the ... (1988) Ultrastructural localization of ATPase activity in the Pinus sylvestrisltaccaria laccata ectomycorrhizal association New P O8, 329-334 7yfo/ / an although The investigations have been supported...
  • 4
  • 229
  • 0
Báo cáo y học:

Báo cáo y học: "Amplification of autoimmune disease by infection" potx

Báo cáo khoa học

... internal sites of inflammation, such as the synovium of an arthritic patient Reactivation of virus at these sites does not serve the purpose of the virus but may aggravate the disease process The ... can infect epithelial and endothelial cells Salivary glands are a major site of production of HHV7 [9,52] HHV6 and HHV7 antigenemia occurs in the setting of CMV reactivation in transplant patients ... Yarilin antigens such as keratin and IgG, the target of typical rheumatoid factors; and apoptosis-related proteins such as annexin V, calpastatin, vimentin and filaggrin [107–115] For the last two antigens,...
  • 11
  • 513
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Real time PCR analyses of expression of E-cadherin, alpha-, beta- and gamma-catenin in human breast cancer for predicting clinical outcome" pps

Báo cáo khoa học

... actgaacctgaccgtacacatgccctcatctaatgtct Primers for human E-Cadherin ECADF8 cagaaagttttccaccaaag ECADZR actgaacctgaccgtacaaaatgtgagcaattctgctt Primers for human γ-catenin gCatF1 aacaagaacaaccccaagtt gCatZr actgaacctgaccgtacatagttacgcatgatctgcac ... α-catenin ACATENINF1 ACATENINZR caacccttgtaaacaccaat actgaacctgaccgtacaccttctccaagaaattctca Primers for human β-catenin BCATENINF8 agggattttctcagtccttc BCATENINZF actgaacctgaccgtacacatgccctcatctaatgtct ... mean background reading Statistical analysis The data obtained was analysed using the MINITAB 13.32 (Minitab Inc State College, PA, USA) programme Statistical significance was calculated using the...
  • 6
  • 303
  • 0
Báo cáo y học:

Báo cáo y học: "Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries" pps

Báo cáo khoa học

... DNA fragments by streptavidin capture Non-phosporylated biotinylated Illumina adapters were prepared by annealing 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCxT and 5’-GATCGGAAGAGC GGTTCAGCAGGAATGCCGAG-3BioTEG ... samples, the average quantity of each amplicon in a given sample was divided by the mean average quantities of the 48% and 52% GC amplicons in the same sample Hence, all GC-bias plots meet at ... 5’-phosphorylation and 3’-single-dA extension of the resulting fragments, adapter ligation, size fractionation on an agarose gel and PCR amplification of adapter-ligated fragments Bias can potentially...
  • 14
  • 346
  • 0
Báo cáo y học:

Báo cáo y học: " Monitoring human cytomegalovirus infection with nested PCR: comparison of positive rates in plasma and leukocytes and with quantitative PCR" doc

Báo cáo khoa học

... follows: the external primers 1a 5’-GGTCACTAGTGACGCTTGTATGATGA-3’, 1b 5’-GATAGTCGCGGGTACAGGGGACTCT-3’; the internal primers 2a 5’-AAGTGAGTTCTGTCGGGTGCT-3’, 2b 5’-GTGACACCAGAGAATCAGA GGA-3’ After ... Clari MA, Remigia MJ, Furio S, Calabuig M, Tormo N, Navarro D: Quantification of DNA in plasma by an automated real-time PCR assay (cytomegalovirus PCR kit) for surveillance of active cytomegalovirus ... M, GallezHawkins GM, Myerson D, Zaia JA, Bowden RA: Plasma polymerase chain reaction for cytomegalovirus DNA after allogeneic marrow transplantation - comparison with polymerase chain reaction...
  • 7
  • 324
  • 1
Báo cáo khoa học:

Báo cáo khoa học: " Nested-multiplex PCR detection of Orthopoxvirus and Parapoxvirus directly from exanthematic clinical samples" pdf

Báo cáo khoa học

... vgfF: CGCTGCTATGATAATCAGATCATT vgfR: GATATGGTTGTGCCATAATTTTTAT vgfF2: ACACGGTGACTGTATCCA vgfR2: CTAATACAAGCATAATAC Reference Fonseca et al., 1998 This study OVB2LF1: TCCCTGAAGCCCTATTATTTTTGT OVB2LR1: ... Trindade et al., 2006 Trindade et al., 2007 Leite et al., 2005 Abrahão et al., upubl Data Abrahão et al., upubl Data Abrahão et al., upubl Data Abrahão et al., upubl Data Abrahão et al., upubl Data ... [21] In the nested step, a pair of internal OPV primers (vgfF2: ACACGGTGACTGTATCCA and vgfR2: CTAATACAAGCATAATAC) were designed from alignment of the vgf sequences of Brazilian VACV strains (Drumond...
  • 5
  • 299
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Rapid PCR detection of group a streptococcus from flocked throat swabs: A retrospective clinical study" ppsx

Báo cáo khoa học

... (GAS) dnaseB assay dnaseB forward primer TGA TTC CAA GAG CTG TCG TG dnaseB reverse primer TGG TGT AGC CAT TAG CTG TGT T IAC TGATTCCAAGAGCTGTCGTGatcaatataacaaacacttgcatatatatact tacgaaactaataactaaataatcaatataaatACACAGCTAATGGCTACACCA ... design and data collection and analysis DR and IM participated in the performance of the PCR assay and data analysis All authors contributed to the preparation of the manuscript All authors read and ... tacgaaactaataactaaataatcaatataaatACACAGCTAATGGCTACACCA Slinger et al Annals of Clinical Microbiology and Antimicrobials 2011, 10:33 http://www.ann-clinmicrob.com/content/10/1/33 then heated at 100°C...
  • 5
  • 320
  • 1
Báo cáo y học:

Báo cáo y học: "Serologic and PCR testing of persons with chronic fatigue syndrome in the United States shows no association with xenotropic or polytropic murine leukemia virus-related viruses" pot

Báo cáo khoa học

... GCCGCCTCTTCTTCATTGTTCTC GagIF GagOR Probe 419 to 1149 GGGGACGAGAGACAGAGACA CAGAGGAGGAAGGTTGTGCT XGagP2 ACCTTGCAGCACTGGGGAGATGTC gag2 Forward AGGTAGGAACCACCTAGTYC Probe 1581 to 1764 RNA from 62 μL RT-PCR using AgPath-ID ... CCGAGGTTCCCTAGGGTTTGTAAT XPOLIF TCCACCCCACCAGTCAGCCTCTCT XPOLIR AAGTGGCGGCCAGCAGTAAGTCAT XPOLP TTGATGAGGCACTGCACAGAGACC gag1 GagOF ATCAGTTAACCTACCCGAGTCGGAC GagOR 0.25 μg DNA; 40 cycles of 94°C for 30 s, 50°C ... primary and nested PCR [9] Reverse GGTGGAGTCTCAGGCAGAAAA Probe [6FAM] TGTTCCAGGGGGACT GGCAAGGTACCAccctgg [DABC]2,3 pol2 CCGTGCCCAACCCTTACAACCTCT XPOLOF XPOLOR CCGAGGTTCCCTAGGGTTTGTAAT XPOLIF TCCACCCCACCAGTCAGCCTCTCT...
  • 7
  • 277
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Long telomeres in the polytene chromosomes of Drosophila melanogaster are associated with amplification of subtelomeric repeat sequences" doc

Báo cáo khoa học

... depending on the organism adaptation to this factor on the action of radiation I Characterization of a Drosophila stock adapted to high temperature Genetika (USSR) 16, 115-122 Traverse KL, Pardue ML ... (Chad, Central Africa) that were subjected to artificial selection for increased heat tolerance (Tikhomirova and Belyatskaya, 1980) Flies of the T-32 strain are exceptional in that they can develop ... squashes prepared (Atherton and Gall, 1972) with minor modifications was In situ by standard procedure hybridization Polytene chromosomes of salivary glands of D larvae were prepared ac-osophila...
  • 10
  • 298
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008