build a model to illustrate the structural layers of earth
Greener Events A guide to reducing the environmental impacts of conferences and seminars potx
Ngày tải lên :
16/03/2014, 19:20
... exhibition areas
[ ] Format any handouts so as to minimise the
amount of paper used
[ ] Where possible, write material in a re-usable
format (general rather than event specific)
[ ] Minimise the ... them at the end of the event!)
[ ] Minimise use of accessories that are harmful to the
environment (e.g. plastic leaflet wallets)
[ ] Feature conference name & date on title slide
rather ... numbers and taking
account of carbon saving measures and energy used at
the conference venue, ENVEC offset 12 tonnes of CO
2
each year.
If your organisation is supporting or managing several...
- 5
- 527
- 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
Ngày tải lên :
08/03/2014, 02:21
... Hierarchy in a modified hidden
Markov model
Lin-Yi Chou
University of Waikato
Hamilton
New Zealand
lc55@cs.waikato.ac.nz
Abstract
This paper explores techniques to take ad-
vantage of the fundamental difference ... hidden Markov models
(HMM) and hierarchical hidden Markov
models (HHMM). The HHMM structure
allows repeated parts of the model to be
merged together. A merged model takes
advantage of the recurring ... structure of an HHMM
The models discussed here are evaluated
by applying them to natural language tasks
based on CoNLL-2004
1
and a sub-corpus
of the Lancaster Treebank
2
.
Keywords: information extraction,...
- 8
- 528
- 0
A STUDY ON THE STRUCTURAL FEATUES OF ENGLISH NEWS STORY.DOC
Ngày tải lên :
02/09/2012, 11:12
... journalist.
3.2.1 Language skills
Language is certainly the main components of the core skills of a
translator. When doing news story translation, the translator is required to
master at least two languages ... can arrange his material in the
descending order of importance details for the second paragraph and save less
important details for succeeding paragraph. The least important part comes at
the ... formed. And the structure is one of the features of the news story’s
paragraph.
According to Do Huu Chau [2]: “Structure is an art of the performance
on content factors of the writers. Structurally,...
- 62
- 1.1K
- 5
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf
Ngày tải lên :
24/09/2012, 17:19
... and trained staffs”.
Therefore MacDonald can be said to have a larger degree of dispersion of data around the
mean than Max hamburger in those attributes. Max hamburger had a larger standard ... hours”. Therefore Max hamburger can be said to have
a larger degree of dispersion of data around the mean than MacDonald in those attributes.
49
adapters tend to be more influenced than early adapters. ...
22
Brand equity
Aaker (1991) stated that brand equity can be referred to as a set of brand assets and
liabilities linked to a brand, its name and symbol that add to or subtract from the value...
- 88
- 986
- 8
Tài liệu How To Use the Six Laws of Persuasion during a Negotiation pptx
Ngày tải lên :
21/12/2013, 04:18
... of
course
, the better).
You can also use this law to appeal to fairness. For example, if the other party manipulates the physical envi-
ronment by requiring that your team sits facing the sun, at the ... that can appeal to the
intellect using logical and objective criteria, as well as a methodology that positively engages the emotions of
the negotiators. The result of a successful negotiation ... or she has to make the deal. If you are
under no time pressure and the other side is, you have the upper hand.
Law of Authority
Vendors often quote v
ague authorities to sell their wares, “Experts...
- 6
- 500
- 0
Tài liệu How To Use the Six Laws of Persuasion during a Negotiation docx
Ngày tải lên :
21/12/2013, 06:18
... part, of
course
, the better).
You can also use this law to appeal to fairness. For example, if the other party manipulates the physical envi-
ronment by requiring that your team sits facing the ... your favor and,
in a win-win situation, provide the other side with a fair deal. This entails a process that can appeal to the
intellect using logical and objective criteria, as well as a methodology ... people what they w
ant via the Six Laws of P
ersuasion,
they’ll most likely return the favor. And when you
recognize that you are being manipulated,
you can call the other side on their tactics and...
- 6
- 502
- 0
Tài liệu The OSI Model: Understanding the Seven Layers of Computer Networks ppt
Ngày tải lên :
24/01/2014, 09:20
... connectivity to millions of networks around the world.
To make it easier to manage the network and control the flow of packets, many organizations separate their
network layer addressing into smaller parts ... (OSPF), to learn of other networks that are present and to calculate the
best way to reach each network based on a variety of criteria (such as the path with the fewest routers).
Routers and other ... application formats the data to be sent out onto the
network. The presentation layer basically allows an application to read (or understand) the message.
Examples of presentation layer functionality include:
•...
- 11
- 542
- 0
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf
Ngày tải lên :
14/02/2014, 21:20
... fullest
particulars regarding victors and vanquished, and there
are champions of the oar and the cricket-field whose
achievements are more familiar to the rising genera-
tion than those of any general, statesman, ... (two of them from accidental causes, one
only three years after the race, and the other only five).
I have calculated that on an average the Oars who
pulled in this match, instead of surviving the ... had disappeared, and whither they had directed
their steps it was no easy matter to ascertain. When,
therefore, I had applied to all their surviving fellow-
Oarsmen without avail, and when also...
- 419
- 541
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
Ngày tải lên :
19/02/2014, 17:20
... CP-pyk
(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT
GACANNNNNNNNNNNNNNTGRTATAATNNNNAA
GTAATAAAATATTCGGAGGAATTTTGAAATGAATA
AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-
back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG
TC-3¢) for amplification of pyk. The resulting PCR prod-
ucts, containing ... pattern. By coregulating
PK and LDH cells can maintain homolactic fermenta-
tion.
The fact that the effects of PK and LDH almost
cancel each other out may also add to the explanation
of why the ... (5¢-GGAAGGA
TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4
(5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were
amplified. The PCR products were digested with XhoI ⁄
BamHI and BamHI ⁄ XbaI, respectively, and cloned...
- 12
- 616
- 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx
Ngày tải lên :
07/03/2014, 12:20
... study of
the mammalian stress response: characterization of
changes in cytoplasmic organelles, cytoskeleton, and
nucleoli, and appearance of intranuclear actin filaments
in rat fibroblasts after heat-shock ... typical scenario, the activa-
tion of growth factor receptors may in turn activate
the Ras ⁄ Rac1 pathway, which has been shown to play
a critical role in HSF1 activation and HSP up-regula-
tion ... shown to increase
HSF1 activity. Enhanced Ras maturation by heat stress
was associated with a heightened activation of extra-
cellular signal-regulated kinase (ERK), a key mediator
of both mitogenic...
- 10
- 452
- 0
Money and happiness a guide to living the good life
Ngày tải lên :
12/03/2014, 14:51
... she says with a laugh. When
she was 14, her parents started a restaurant, and she began waitressing
at night. Her father encouraged her to save up for substantial needs, like
a car, rather than ... mother
had the last laugh,” Deb says. “She has had a fabulous retirement, she
and her boyfriend ride around [Florida’s] intercoastal waterway on their
yacht. My father had health setbacks and ... would ask, “What’s
the meaning of life?”
This book offers a road map to wealth with practical financial tools
and positive strategies for creating the good life” in a personally mean-
ingful way....
- 258
- 358
- 0
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt
Ngày tải lên :
16/03/2014, 05:20
... dsRNA,
DNA corresponding to the mature peptide of MeMIH-B
was amplified by PCR using T7 promoter-linked primers
(forward, 5¢-TAATACGACTCACTATAGGTACTATG
TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC
ACTATAGGTACTTTAAAGTCCCGGGTTGA-3¢). ... Tsutsui N, Saido-Sakanaka H, Yang WJ, Jayasankar V,
Jasmani S, Okuno A, Ohira T, Okumura T, Aida K &
Wilder MN (2004) Molecular characterization of a
cDNA encoding vitellogenin in the coonstriped ... of rMIH-B at the arthropodial
membrane of the periopod and returned to the culture
tanks. At 24, 48 and 72 h after injection, the hepatopan-
creas and ovary of the shrimp were dissected for total
RNA...
- 11
- 546
- 0
A Strategy to Engage the Private Sector in Climate Change Adaptation in Bangladesh docx
Ngày tải lên :
16/03/2014, 14:21
... 2010
A Strategy to Engage th
e Private Sector in
Climate Change Adaptation in Bangladesh
in Bangladesh
44
Appendix 2: The Bangladesh Climate Change Action Plan
The Climate Change Action ... paper to the LEG Stocktaking meeting on the
preparation and implementation of National Adaptation
Programmes of Action. Available at
http://unfccc.int/files/meetings/application/pdf/stocktaking-
paper.pdf ... delivered at the individual level include poor rural
infrastructure and capacity; operational difficulties of small
farmer agriculture; lack of availability of farm level data;
moral hazard; adverse...
- 49
- 557
- 0
- timing problems require a mechanism to synchronize the transmitter and receiver two solutions asynchronous synchronous
- build a model of earths layers
- how to build a model of the layers of the atmosphere
- is a way to measure the rate of motion
- how to find the maximum value of y on a graph
- a cancer of the deepest layers of the skin is called
- david lindsay a voyage to arcturus the original classic edition
- how to view the html source of a web page
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2