... sense disambiguated,vastly multilingual dictionary called PANDIC-TIONARY (Mausam et al., 2009). PANDIC-TIONARY is automatically constructed by prob-abilistic inference over a graph of translations,which ... the ACL-IJCNLP 2009 Conference Short Papers, pages 193–196,Suntec, Singapore, 4 August 2009.c2009 ACL and AFNLP A RoseisaRoosisa Ruusu: Querying Translations for Web Image SearchJanara ... dictionary is 0.9(evaluated based on a random sample). PANDIC-TIONARY has about 80,000 senses and about 1.8million translations at precision 0.9.We use Google Image Search as our underlyingimage...
... in this lab is configured as a standalone server that isa member of a workgroup.Note that it is not required that the remote ISA/VPN server be a standalone server that isa member of a workgroup ... be able to decrypt data using this certificate (if you remove it). Click Yes. Configuring a gateway to gateway VPN is easy using ISA Server. The reason why it’s so easy is that the Local and ... Certificate database and Certificate Database Log. You have the option to Store configuration information in a shared folder, but this is not required unless you want other CAs in your organization...
... soy arabinogalactan consists of 57%D-galactose and 38%L-arabinose. Methylation analysisdemonstrated that a substantial amount of theL-arabinoseresidues (14%) in soy arabinogalactan is ... determined as described [21].Onion arabinogalactan consists of 99%D-galactose and0.3%L-arabinose and is predominantly linear. Potatoarabinogalactan consists of 86%D-galactose and 6.6%L-arabinose, ... substituted with a) 1-,3-linkedL-arabinofuranose chains.Type I arabinogalactan is degraded by b-1,4-endogalacta-nase and b-galactosidase. b-1,4-Endogalactanases cleavewithin the galactan moiety...
... mathematician:. . . all the different fields of mathematics are as inseparable as thedifferent parts of a living organism; as a living organism mathe-matics has to be permanently recreated; each ... CHAPTER 0. WHAT ISA PROOF AND WHY?bulletpro of solidity of mathematics (see also Section 0.9). But mathematics is applied in a variety of ways, in a vast panorama of disciplines. And theapplications ... become a dis-organised mass of details and complexities. In other words, at a great distance from its empirical source, or after much “abstract”inbreeding, a mathematical subject is in danger...
... Murakami, Y., Matsufuji, S., Kameji, T., Hayashi, S., Igarashi,K., Tamura, T., Tanaka, K. & Ichihara, A. (1992) Ornithinedecarboxylase is degraded by the 26S proteasome withoutubiquitination. ... 647–651.29. Kahana, C. & Nathans, D. (1984) Isolation of cloned cDNAencoding mammalian ornithine decarboxylase. Proc. Natl Acad.Sci. USA 81, 3645–3649.30. Graham, F.L. & van der Eb, A. J. (1973) ... degradation.DISCUSSIONAntizyme isa unique cellular regulatory protein that is bothregulated by polyamines and regulates polyamine metabo-lism in a feedback loop. Antizyme expression is regulatedtranslationally...
... sys-tematically training the graph-based REG algorithmon a number of “semantically transparent” data setsof various sizes and evaluating on a held-out testset. The graph-based algorithm seems a ... Corpora for NaturalLanguage Generation: Language Generation and Ma-chine Translation (UCNLG+MT), pages 90–92.Ruud Koolen and Emiel Krahmer. 2010. The D-TUNAcorpus: A Dutch dataset for the evaluation ... Trainable speaker-based refer-ring expression generation. In Twelfth Conference onComputational Natural Language Learning (CoNLL-2008), pages 151–158.Albert Gatt, Ielka van der Sluis, and...
... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG 2459 AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC 2519 TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG 2639 TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT 2699 TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC ... CCGCAGCTCAGTGGTGTCAAGGCCCATGTCACACTCAATGTCAAGAGTGCTTAATTTGCT 2279 P Q L S G V K A H V T L N V K S A * ATGCGAGGTCAGCATTTATCCAACCAGAAGCTTCACGGAGCTAGCTGGGCAAGGAAATTT 2339 GATAATCGCAAGAAATAATTTCCCCCCAAAAACAAAAGGTTGTTGGCTGAAAATACTTCT 2399 ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG...
... this ebook, I discuss one functional transformation that has taken placed as a result of cloud services, namely; the impact on the assessment of value. This isa timely discourse as the vast ... being available anywhere, at anytime and on any device.If it was only a simple as a mouse-trap.The complication is that for most customers they already have an IT investment. So the assessment ... the traditional performance measure is not relevant because it doesn’t factor in agility/flexibility. Attempts to incorporate this into the traditional performance measure are absurd. It is pure...
... purchased from Sigma-Aldrich. The human Grx3 shRNA1 sequence is 5¢-CCGGGCTCTTTATGAAAGGAAACAACTCGAGTTGTTTCCTTTCATAAAGAGCTTTTTG-3¢. The human Grx3shRNA2 sequence is 5¢ -CCGGGAACGAAGTTATGGCAGAGTTCTCGAGAACTCTGCCATAACTTCGTTCTTTTTG-3¢. ... weused the forward primer 5¢-GCCGGATCCATGACTGTGGTTGAAATAAAAAG-3¢ and the reverse primer 5¢-CCGGAGCTCTTACTGTAGAGCATGTTGGAAATA-3¢. Full-length cDNA of HsGrx3 and MmGrx3 were amplified byPCR ... identified by amplifica-tion of 450 bp of PCR product using a Grx3 forward pri-mer: 5¢-CCTAGAAGGTAACCCTAAAATGTC-3¢ and a Grx3 reverse primer: 5¢-CCATCACTGCGTTACTCCAGA-3¢. A mutant allele could...
... Experi-mentation and Animal Care.Preparation of postnuclear fractions and SDS/PAGEanalysisThe livers and intestinal mucosa from wild (C57BL) orPPARa-null mice fed a control or a diet containingWy14 ... The amount of PPARa in the mouse liver is 10 timeshigher than that in human liver, and fibrates, hypolipidemicdrugs and PPARa agonists do not cause peroxisomeproliferation and a large induction ... Tran-scription of t he peroxisomal hydratase-dehydrogenase(HD) and L-FABP genes is activated by PPARa within a few hours and the m RNAs reach their maximal levels i n a day in t he liver but not in...
... types and key regulatory factors. Clin. Diagn. Lab. Immunol. 9,530–543.26. Funatogawa, K., Matsuura, M., Nakano, M., Kiso, M. & Hase-gawa, A. (1998) Relationship of structure and biological ... lipopolysaccharide from Salmonellaabortus equi. Zentbl. Bakteriol. Mikrobiol. Hyg. Abt. 1 Orig. A 243,226–244.30. Adachi, Y., Satokawa, C., Ohno, N., Tamura, H., Tanaka, S. &Yadomae, T. ... thedownstream 47 base pairs, designated NF-jBd (5¢-CATGGG GAC TCT CCC TTT GGG AAC AGT TAT GCAAAA TAG CTC TGC AGA GCC TGG AGG GGTCGA-3¢) [12] and the IRF-1 consensus sequence oligo-nucleotide (5¢-GGA...