0

a rose is a roos is a ruusu

Báo cáo khoa học:

Báo cáo khoa học: "A Rose is a Roos is a Ruusu: Querying Translations for Web Image Search" pdf

Báo cáo khoa học

... sense disambiguated,vastly multilingual dictionary called PANDIC-TIONARY (Mausam et al., 2009). PANDIC-TIONARY is automatically constructed by prob-abilistic inference over a graph of translations,which ... the ACL-IJCNLP 2009 Conference Short Papers, pages 193–196,Suntec, Singapore, 4 August 2009.c2009 ACL and AFNLP A Rose is a Roos is a Ruusu: Querying Translations for Web Image SearchJanara ... dictionary is 0.9(evaluated based on a random sample). PANDIC-TIONARY has about 80,000 senses and about 1.8million translations at precision 0.9.We use Google Image Search as our underlyingimage...
  • 4
  • 294
  • 0
Configuring a gateway to gateway VPN is easy using ISA Server

Configuring a gateway to gateway VPN is easy using ISA Server

Quản trị mạng

... in this lab is configured as a standalone server that is a member of a workgroup.Note that it is not required that the remote ISA/VPN server be a standalone server that is a member of a workgroup ... be able to decrypt data using this certificate (if you remove it). Click Yes. Configuring a gateway to gateway VPN is easy using ISA Server. The reason why it’s so easy is that the Local and ... Certificate database and Certificate Database Log. You have the option to Store configuration information in a shared folder, but this is not required unless you want other CAs in your organization...
  • 38
  • 370
  • 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Báo cáo khoa học

... AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ PDIP46(2) ⁄ SKAR(b) AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCCGCGGGATCCCGGATGCTGGCAGCGTGGGTTGGpYESTrp2 ... GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGpEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTTGCGGGATCCCGTTTCCCAGCCTGTTGGGCCTpEGFP-N1 ⁄ PDIP46(1) ⁄ SKAR (a) AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ... GCGGGATCCCTCAGCCCATTGGAAGGCACCATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAGpYESTrp2 ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCCpYESTrp2 ⁄ PDIP46⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAGATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGTpYESTrp2...
  • 14
  • 517
  • 0
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

Báo cáo khoa học

... 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAGReverse ompA105 5¢-GCCATGAATATCTCCAACGAGReverse ompA117 5¢-CATCCAAAATACGCCATGAATATCForward 5¢rpsO 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCGReverse 5¢rpsO 5¢-GCTTCAGTACTTAGAGACForward ... 5¢-GCTTCAGTACTTAGAGACForward 3¢rpsO 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACCReverse 3¢rpsO 5¢-GAAAAAAGGGGCCACTCAGGReverse 3¢rpsO-(T)18 5¢-T(18)GAAAAAAGGGGCCACTCAGGForward rpsO internal 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTGReverse ... 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTGReverse 3¢rpsO-(C)18 5¢-C(18)GAAAAAAGGGGCCACTCAGGReverse 3¢rpsO-(G)18 5¢-G(18)GAAAAAAGGGGCCACTCAGGReverse 3¢rpsO-(N)18 5¢-GAATTGCTGCCGTCAGCTTGAForward oxyS109* 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTTReverse...
  • 10
  • 488
  • 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Báo cáo khoa học

... soy arabinogalactan consists of 57%D-galactose and 38%L-arabinose. Methylation analysisdemonstrated that a substantial amount of theL-arabinoseresidues (14%) in soy arabinogalactan is ... determined as described [21].Onion arabinogalactan consists of 99%D-galactose and0.3%L-arabinose and is predominantly linear. Potatoarabinogalactan consists of 86%D-galactose and 6.6%L-arabinose, ... substituted with a) 1-,3-linkedL-arabinofuranose chains.Type I arabinogalactan is degraded by b-1,4-endogalacta-nase and b-galactosidase. b-1,4-Endogalactanases cleavewithin the galactan moiety...
  • 9
  • 669
  • 0
Tài liệu The Proof is in the Pudding - A Look at the Changing Nature of Mathematical Proof doc

Tài liệu The Proof is in the Pudding - A Look at the Changing Nature of Mathematical Proof doc

Cao đẳng - Đại học

... mathematician:. . . all the different fields of mathematics are as inseparable as thedifferent parts of a living organism; as a living organism mathe-matics has to be permanently recreated; each ... CHAPTER 0. WHAT IS A PROOF AND WHY?bulletpro of solidity of mathematics (see also Section 0.9). But mathematics is applied in a variety of ways, in a vast panorama of disciplines. And theapplications ... become a dis-organised mass of details and complexities. In other words, at a great distance from its empirical source, or after much “abstract”inbreeding, a mathematical subject is in danger...
  • 334
  • 515
  • 0
Tài liệu Báo cáo Y học: Ornithine decarboxylase-antizyme is rapidly degraded through a mechanism that requires functional ubiquitin-dependent proteolytic activity pot

Tài liệu Báo cáo Y học: Ornithine decarboxylase-antizyme is rapidly degraded through a mechanism that requires functional ubiquitin-dependent proteolytic activity pot

Báo cáo khoa học

... Murakami, Y., Matsufuji, S., Kameji, T., Hayashi, S., Igarashi,K., Tamura, T., Tanaka, K. & Ichihara, A. (1992) Ornithinedecarboxylase is degraded by the 26S proteasome withoutubiquitination. ... 647–651.29. Kahana, C. & Nathans, D. (1984) Isolation of cloned cDNAencoding mammalian ornithine decarboxylase. Proc. Natl Acad.Sci. USA 81, 3645–3649.30. Graham, F.L. & van der Eb, A. J. (1973) ... degradation.DISCUSSIONAntizyme is a unique cellular regulatory protein that is bothregulated by polyamines and regulates polyamine metabo-lism in a feedback loop. Antizyme expression is regulatedtranslationally...
  • 7
  • 382
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Does Size Matter – How Much Data is Required to Train a REG Algorithm?" potx

Báo cáo khoa học

... sys-tematically training the graph-based REG algorithmon a number of “semantically transparent” data setsof various sizes and evaluating on a held-out testset. The graph-based algorithm seems a ... Corpora for NaturalLanguage Generation: Language Generation and Ma-chine Translation (UCNLG+MT), pages 90–92.Ruud Koolen and Emiel Krahmer. 2010. The D-TUNAcorpus: A Dutch dataset for the evaluation ... Trainable speaker-based refer-ring expression generation. In Twelfth Conference onComputational Natural Language Learning (CoNLL-2008), pages 151–158.Albert Gatt, Ielka van der Sluis, and...
  • 5
  • 355
  • 0
Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starfish embryogenesis ppt

Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starfish embryogenesis ppt

Báo cáo khoa học

... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG 2459 AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC 2519 TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG 2639 TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT 2699 TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC ... CCGCAGCTCAGTGGTGTCAAGGCCCATGTCACACTCAATGTCAAGAGTGCTTAATTTGCT 2279 P Q L S G V K A H V T L N V K S A * ATGCGAGGTCAGCATTTATCCAACCAGAAGCTTCACGGAGCTAGCTGGGCAAGGAAATTT 2339 GATAATCGCAAGAAATAATTTCCCCCCAAAAACAAAAGGTTGTTGGCTGAAAATACTTCT 2399 ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG...
  • 11
  • 501
  • 0
What is the price of a mousetrap? The assessment of value from cloud services pptx

What is the price of a mousetrap? The assessment of value from cloud services pptx

Quản trị kinh doanh

... this ebook, I discuss one functional transformation that has taken placed as a result of cloud services, namely; the impact on the assessment of value. This is a timely discourse as the vast ... being available anywhere, at anytime and on any device.If it was only a simple as a mouse-trap.The complication is that for most customers they already have an IT investment. So the assessment ... the traditional performance measure is not relevant because it doesn’t factor in agility/flexibility. Attempts to incorporate this into the traditional performance measure are absurd. It is pure...
  • 3
  • 507
  • 0
Báo cáo khoa học: A mammalian monothiol glutaredoxin, Grx3, is critical for cell cycle progression during embryogenesis doc

Báo cáo khoa học: A mammalian monothiol glutaredoxin, Grx3, is critical for cell cycle progression during embryogenesis doc

Báo cáo khoa học

... purchased from Sigma-Aldrich. The human Grx3 shRNA1 sequence is 5¢-CCGGGCTCTTTATGAAAGGAAACAACTCGAGTTGTTTCCTTTCATAAAGAGCTTTTTG-3¢. The human Grx3shRNA2 sequence is 5¢ -CCGGGAACGAAGTTATGGCAGAGTTCTCGAGAACTCTGCCATAACTTCGTTCTTTTTG-3¢. ... weused the forward primer 5¢-GCCGGATCCATGACTGTGGTTGAAATAAAAAG-3¢ and the reverse primer 5¢-CCGGAGCTCTTACTGTAGAGCATGTTGGAAATA-3¢. Full-length cDNA of HsGrx3 and MmGrx3 were amplified byPCR ... identified by amplifica-tion of 450 bp of PCR product using a Grx3 forward pri-mer: 5¢-CCTAGAAGGTAACCCTAAAATGTC-3¢ and a Grx3 reverse primer: 5¢-CCATCACTGCGTTACTCCAGA-3¢. A mutant allele could...
  • 15
  • 314
  • 0
Báo cáo khoa học: 17b-Hydroxysteroid dehydrogenase type 11 is a major peroxisome proliferator-activated receptor a-regulated gene in mouse intestine pdf

Báo cáo khoa học: 17b-Hydroxysteroid dehydrogenase type 11 is a major peroxisome proliferator-activated receptor a-regulated gene in mouse intestine pdf

Báo cáo khoa học

... Experi-mentation and Animal Care.Preparation of postnuclear fractions and SDS/PAGEanalysisThe livers and intestinal mucosa from wild (C57BL) orPPARa-null mice fed a control or a diet containingWy14 ... The amount of PPARa in the mouse liver is 10 timeshigher than that in human liver, and fibrates, hypolipidemicdrugs and PPARa agonists do not cause peroxisomeproliferation and a large induction ... Tran-scription of t he peroxisomal hydratase-dehydrogenase(HD) and L-FABP genes is activated by PPARa within a few hours and the m RNAs reach their maximal levels i n a day in t he liver but not in...
  • 6
  • 272
  • 0
Báo cáo khoa học: A pathway through interferon-c is the main pathway for induction of nitric oxide upon stimulation with bacterial lipopolysaccharide in mouse peritoneal cells pot

Báo cáo khoa học: A pathway through interferon-c is the main pathway for induction of nitric oxide upon stimulation with bacterial lipopolysaccharide in mouse peritoneal cells pot

Báo cáo khoa học

... types and key regulatory factors. Clin. Diagn. Lab. Immunol. 9,530–543.26. Funatogawa, K., Matsuura, M., Nakano, M., Kiso, M. & Hase-gawa, A. (1998) Relationship of structure and biological ... lipopolysaccharide from Salmonellaabortus equi. Zentbl. Bakteriol. Mikrobiol. Hyg. Abt. 1 Orig. A 243,226–244.30. Adachi, Y., Satokawa, C., Ohno, N., Tamura, H., Tanaka, S. &Yadomae, T. ... thedownstream 47 base pairs, designated NF-jBd (5¢-CATGGG GAC TCT CCC TTT GGG AAC AGT TAT GCAAAA TAG CTC TGC AGA GCC TGG AGG GGTCGA-3¢) [12] and the IRF-1 consensus sequence oligo-nucleotide (5¢-GGA...
  • 10
  • 395
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25