a quantitative genetic analysis of the ricker model
Báo cáo y học: "Genetic analysis of the human infective trypanosome Trypanosoma brucei gambiense: chromosomal segregation, crossing over, and the construction of a genetic map" doc
... genetic map of T b gam- Marker segregation proportions The availability of segregation data across the length of each chromosome allows a full analysis of the inheritance of the STIB 386 parental chromosome ... following additional data are available with this paper Additional data file provides segregation data Additional data file provides a comparison with the physical and genetic maps of T b brucei ... experiments, analyzed the data, and wrote the manuscript AC, LS, ATw, and LM carried out the experimental work All authors read and approved the final manuscript 14 15 16 Additional data files The following...
- 12
- 281
- 0
Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"
... cortex and pyramidal tract to the ventral brain stem The involuntary path is comprised of amygdala, thalamic, hypothalamic, and subthalamic areas, in addition to the dorsal brain stem Moreover, the ... pathways, the “voluntary path” and the “involuntary path” otherwise known as the “emotionally-driven path” (5) The voluntary pathway begins from the premotor opercular areas and travels via the ... Statistical analysis The data was analyzed using both parametric and non parametric statistics and the specific test used was indicated with the respective results If assumptions of normality and...
- 12
- 757
- 0
A critical discourse analysis of the news on north korean missile launches part 3
... Positivization of the US- Japan coalition’s activities in VOA Table Lexicalization of North Korea’s activities in Nhan Dan Table Lexicalization of the US-Japan coalition’s activities in Nhan Dan Table ... LIST OF TABLES Table Names for US-Japan coalition and North Korea in VOA Table Names for US-Japan coalition and North Korea in Nhan Dan Table Negativization of North Korea’s activities in VOA Table ... Over-lexicalization of the North Korea’s missile launches in VOA Table Over-lexicalization of the North Korea’s missile launches in Nhan Dan Table Quotation patterns of news reports in VOA Table 10...
- 4
- 828
- 6
A critical discourse analysis of the news on north korean missile launches part 4
... from the Voice of America and Nhan Dan These two sources are chosen as the database for the analysis as they are both popular and reliable sources of information 2.1.1.1 Voice Of America The Voice ... the rationale, the scope of the research, the aims of the research, the methodology and the design of the research - Part 2- Development: This is the main part of the thesis and has three chapters ... particularly associated with Michael Halliday (Halliday 1978, 1994), is an approach to language that views language in its social context, as an instrument of social interaction, rather than a...
- 20
- 811
- 0
A critical discourse analysis of the news on north korean missile launches part 5
... neutral and formal names to refer to both North Korea and the US- Japan coalition, Nhan Dan treated them equally and viewed them as having equal right and power The analysis of lexicalization further ... explicitly associates the US and Japan with positive values and goals 3.2.2.2 Nhan Dan The analysis of lexicalization shows that in Nhan Dan the wordings for North Korea’s and the US- Japan coalition’s ... processes are attributed to the US and Japan (76.9%) and all these processes are either verbal (60%) or material (40%) The US and Japan play the role of actor and sayer in all the processes In material...
- 28
- 603
- 1
A critical discourse analysis of the news on north korean missile launches part 6
... II APPENDIX Headlines from Nhan Dan ND1* Triều Tiên thử tên l a, Mỹ Nhật Bản đe d a trừng phạt 05/07/2006 ND2* Trung Quốc quan tâm, Nhật Bản tiếp tục đàm phán vấn đề tên l a Triều Tiên ... Trung Quốc Nga đ a dự thảo nghị vấn đề tên l a Triều Tiên 13/07/2006 ND10 Các nước thường trực HĐBA LHQ họp vấn đề tên l a Bình Nhưỡng 14/07/2006 ND11* LHQ thông qua nghị vấn đề tên l a Triều Tiên ... trừng phạt thêm Mỹ Triều Tiên 21/07/2006 Note : The news reports marked with (*) are sampled for full-text analysis III ...
- 3
- 761
- 3
A critical discourse analysis of the news on north korean missile launches part 8
... of America and Nhan Dan Aims of the research To provide a textual analysis To give an illustration of CDA concepts and analysis procedures To convey a message Research questions What are the ... VOA Formal and neutral names for the US and Japan Negative names for NK Nhan Dan formal and neutral names for both groups of participants lexicalization VOA Negativization of NK’s activities ... the roles ? Analyzing full-text news reports Naming referents Lexicalization Over-lexicalization Quotation patterns Data analysis and discussion Analysis of headlines Analysis of full-text...
- 23
- 712
- 0
A Cost-Benefit Analysis of the National Guard Youth ChalleNGe Program pot
... their educational attainment when they were age 20 but also their annual labor market earnings through their early 40s and beyond The NLSY79 also has the advantage of including a measure of aptitude ... Table 4.4 Estimated Effect of Educational Attainment at Age 20 on the PDV of Cash Transfers Educational Attainment at Age 20 GED Estimated Effect of Educational Attainment on PDV of Cash Transfers ... for the fact that the ChalleNGe program evaluation sample contains a higher proportion of males, African-Americans, and Hispanics than does the NLSY79 sample (see Table 4.3) The table also makes...
- 69
- 342
- 0
báo cáo khoa học: " Is globalization healthy: a statistical indicator analysis of the impacts of globalization on health" doc
... confounders in the final models could also be important mediating/causal factors in the association between the mortality rates and the MGI Either way, in all multivariate models, the association between ... quality, reflecting the different capabilities and priorities of the organisations collecting the data Of particular concern are the domains in which the underlying data Martens et al Globalization ... in the sensitivity analysis, the country rankings are consistent for approximately half of the countries The allocation of the weights must be evaluated with care according to its analytical rationale,...
- 14
- 532
- 0
Báo cáo y học: " Quantitative trait analysis of the development of pulmonary tolerance to inhaled zinc oxide in mice" pdf
... chromosome that is associated Plot of a3 BAL protein phenotype from analysis of the entire Plot of a significant QTL on chromosome that is associated with the BAL protein phenotype from analysis of the ... transcriptional activation Biol Chem 1999, 380:953-959 Nakano H, Oshima H, Chung W, Williams-Abbott L, Ware CF, Yagita H, Okumura K: TRAF5, an activator of NF-kappaB and putative signal transducer ... phenotypes, ated of Plotswith thefrom analysis ofchromosomes and associPlots of suggestive QTLs on chromosomes and associated with the BAL PMN and macrophage phenotypes, respectively, from analysis of the...
- 12
- 273
- 0
Báo cáo y học: "Effect of dexmedetomidine versus lorazepam on outcome in patients with sepsis: an a priori-designed analysis of the MENDS randomized controlled trial" doc
... collection, analysis, and interpretation of the data; in the preparation, review, or approval of this manuscript; or in the publication strategy of the results of this study These data are not being ... clinical and preclinical study is warranted into the potential benefits of sedation with drugs targeting the α2 adrenoceptor rather than the GABAA receptor Abbreviations APACHE: Acute Physiology and ... content of arousal), and not as much by level of arousal Septic patients sedated with DEX additionally had a lower risk of death at 28 days as compared with those sedated with LZ (hazard ratio (HR)...
- 12
- 421
- 0
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
... measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... GTAACCAGTACGAAAAAAGATA CATTT 1165 MSC1F TCTTCGGATCACCCAGTTTC 1278 NPT1 5' 1166 MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT CTTT 1084 CTT1F AAAGAGTTCCGGAGCGTGTA 1279 NPT1 3' CAGGGTGTGGAAGAACAGGT ... contributions AG designed and carried out the majority of the experiments, analyzed the data and drafted and edited the manuscript GL, DCS, and DJW processed and analyzed array data KJ and AW carried...
- 17
- 432
- 0
danielsson saltoglu-anatomy of a market crash - a market microstructure analysis of the turkish overnigh~0
... strategy Journal of Financial and Quantitative Analysis, 31(2):213–231 Hartmann, P., Manna, M., and Manzanares, A (2001) The microstructure of the euro money market Journal Money Credit and Banking, ... trading day Throughout the trading day market participants are trading an asset that only exchanges hands after trading ceases Since a one day repo today is not the same asset as a one day repo ... minimal The data set contains detailed information on each transaction in the sample period, i.e whether the transaction was a market borrow or market lend, the annual interest rate, quantity, and...
- 35
- 265
- 0
a corpus-based analysis of the collocates of the word homeland in the 1990s, 2000s and 2010s = nghiên cứu đồng định vị của từ homeland qua các thập niên 1990, 2000 và 2010 trên cơ sở ngôn ngữ học khối liệu
... describe a corpus-based analysis of the collocates of the word “homeland” The data for the analysis were taken from two popular corpora which are Corpus of Contemporary American English and Time Magazine ... view of the definition of the corpus, many of them share the same following characteristics of the corpus: - The language must be authentic rather than made-up - The collection of data must be ... quantitative and qualitative analytical techniques Corpus linguistics and Discourse analysis Corpus-based approach is found to be of great value since it can be applied to a number of areas of...
- 40
- 433
- 0
A Cross-Cultural Analysis of the Metaphorical Conceptualization of Sadness in Modern English and Vietnamese
... be available: (4) a in a bad way b reach at the end of one’s tether c at the end of one’s rope d lead a dog’s life The examples of (4) show that the experiencer of intense SADNESS lands in an ... conceptualizations of SADNESS in Vietnamese, cross-linguistic and cross-cultural analysis of the conceptualizations between the two languages, and conclusions Methods of data collection and analysis ... addition, the mappings of HEAVY and SINKING have an overall negative cognitive connotation: they imply an unpleasant experience (emotional in the case of SADNESS; physiological in the cases of...
- 15
- 467
- 0
Genetic analysis of the role of ARP2 3 complex in border cell migration in drosophila melanogaster
... them ARPC2 and ARPC4 contact the mother filament, whereas ARP2 and ARP3 associated with the pointed end of the nascent filament (Rouiller et al 2008) The structural organization of Arp2 and Arp3 ... the membrane forward at the leading edge, while filopodia are responsible for detecting extracellular chemoattractants As a cell migrates through a gradient of chemoattractant, the polarity of ... creation of a new artificial gap, by scratching a confluent cell monolayer Shortly after the generation of the “scratch” gap, the rows of cells on the edge of the gap will reorient and polarized...
- 133
- 355
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25