... Investigaciones Cientı´ ficas y ´ ´ Tecnicas (CONICET), Secretarı´ a de Ciencia y Tecnica de la Univer´ ´ sidad Nacional de Cordoba y Agencia Cordoba Ciencia del Gobierno ´ de la Provincia de Cordoba, ... y Tecnologica de la Secretarı´ a de Ciencia y Tecnologı´ a del Ministerio de Cultura y ´ ´ ´ Educacion en el marco del Programa de Modernizacion Tecnologica (BID 802/OC-AR), Consejo Nacional de ... 1A) Inclusion of mM nonradioactive nitrotyrosine in the incubation system led to reduced incorporation of radioactivity In this case, as calculated from the speci c radioactivity and tubulin content...
... issue are warranted Competing interests The author(s) declare that they have no competing interests References 532 Villa P, Jiménez M, Soriano MC, Manzanares J, Casasnovas P: Serum cystatin C as a ... marker of acute renal dysfunction in critically ill patients Crit Care 2005, 9:R139-R143 O’Riordan SE, Webb MC, Stowe HJ, Simpson DE, Kandarpa M, Coakly AJ, Newman DJ, Saunders JA, Lamb EJ: Cystatin ... filtration rate in renal transplant recipients Clin Chem 1999, 49:1866-1868 Coll E, Botey A, Alvarez L, Poch E, Quintó LI, Taurina A, Vera M, Piera C, Darnell A: Serum cystatin C as a new marker...
... meaning and expression develop together Today educators have become aware ofthe importance of cultural factors in the teaching of speaking skills and, too , aware ofthe great influence of inferences ... by the language, not as a feature of language itself, culture awareness becomes an educational objective in social practice, and culture becomes the very core of language teaching.” (Kramsch, ... amount of grammar and vocabulary, teachers must be aware ofthe contribution of other factors involved in speaking 1.3 Cultural factors in the teaching and learning of speaking skills in classrooms...
... inserted into a pBluescript vector, was used as template for the amplification ofthe MUC5AC sequence With use ofthe primer pair 5¢-TATTCTAGAG AAGAGGGCCT GGTGTGCCGG AACCAGGACC AGCAGGGACC CTTCAAG-3¢ ... (GH262) and 5¢-ACGCGCTAGC TCAATGATGA TGATGATGGT GCATGGGGGA CACTGGGACG CC-3¢ (GH263), the MUC5AC-encoding sequence could be amplified by PCR 45M1, a human mAb against MUC5AC The primer GH262 introduced ... used as a template for PCR With use ofthe primer pair 5¢-GCTTCTAGAC ACGAGAAGAC AACCC ACTCC C- 3¢ (GH287) and 5¢-GCGAGGTCTC TGTGG CGGTA TATGGTG-3¢ (GH288), the 5¢-part missing in the L31 clone could...
... sequences The database is hosted at NCBI Functional classification according to Human Protein Reference Database Protein description Biological process Molecular function NCBI accession number SSPa ... similar to collagen alpha 2(V) chain precursor PREDICTED: similar to elongation factor PREDICTED: similar to filamin A isoform PREDICTED: similar to fructose-bisphosphate aldolase A isoform PREDICTED: ... corresponding quadrant section) Gel replicates Reference gel Condition Quadrant Replicate Replicate Replicate Replicate Replicate Level match-set Activated meprin Non-activated meprin In total Activated...
... substrates The data for the PA catalysed hydrolysis of PhAc-Asp and PhAc-Glu [13] and our data for PhAc-pAB, PhAc-mAB and PhAcoAB (Table 2) imply that the COOH group has to be positioned as in NIPAB ... substrates are arranged in a decreasing order ofthe ratio of their specificity constant tothe specificity constant of phenylacetamide (PhAc-NH2), used as a reference because it implies no interactions ... protein chain, acting as a flap, first opening and then closing the groove [45] The catalytic reaction presumably occurs when the ionized carboxyl group of PG approaches the guanidine side chain of ArgA145,...
... experiment, a spectrum of 200 scans, 512 K data points was collected The spectrum was calibrated using a dataset ofa sample of standard peptides After calibration, the masses ofthe standard peptides ... proglucagon is tissue-speci c In the pancreatic a- cells, the main products are glucagon, GRPP and the major proglucagon fragment [40,41] Glucagon is known to cause an increase in the blood glucose ... 2003 LC-FTICR MS of pancreatic peptides (Eur J Biochem 270) 3147 electrons that take place in the cell at ultra-high vacuum (10)10)10)9 Torr) The advantage of ECD compared to other fragmentation...
... salt concentrations affect the calcium-induced activation Our observations that the ionic strength is not of importance for the activation was also reflected by the fact that the activation was ... the CaCl2induced conversion ofthe complex to lower Mr forms ofthe gelatinase, as well as the cABC degradation ofthe CS-chains ofthe PG The presence of 4.5 M urea in the proMMP-9/CSPG preparation ... chemical properties of calcium As expected, the degradation and removal of CS-chains from the complex resulted in the disappearance or a large reduction ofthe bands in the stacking gel and the band...
... Consequence of Change Employees’ Reactions to Change Active Resistance to Change Perceived Change in Power Factors concerning Actual & Expected Consequences ofthe Change Passive Resistance to ... resistance to change Indicator for active resistance to change Active support for change Indicator for active support for change Indicator for active support for change Indicator for active support ... characteristics One ofthe central issues of organizational change concerns the ability ofthe organization to enact change.15 The ability may be partly limited by organizational inertia; that...
... reported to function as transcriptional activators of cold-induced genes such as hns [36] and gyrA, encoding a subunit of DNA gyrase [37] The ability of CSP to bind to singlestranded nucleic acids and ... nucleobases are given at the bottom B Fig DNA single strands adopt an irregular conformation upon binding to Bc-Csp The sugar–phosphate backbone appears curved like aC character All nucleobases ... assumes the dissociation ofa nascent transcript from the DNA upon stem–loop formation at the terminator site When the adjacent uracil-rich sequence is being transcribed, the affinity ofthe dA–U base...
... statistical analysis, and data interpretation, and drafted the manuscript AA performed the statistical analysis VMF and SJP participated in the data acquisition and interpretation QZ participated ... (University of California at San Francisco, San Francisco, CA) Clinical Centers: Sylvia Wassertheil-Smoller (Albert Einstein College of Medicine, Bronx, NY); Aleksandar Rajkovic (Baylor College of Medicine, ... search [25] Cysteine alkylation with the light form of acrylamide was set as a fixed modification and with the heavy form of acrylamide (+3.01884) as a variable modification The database search...
... AAAGAATTCTTAATCCTCACAATTATCGCTCTTATT c AAAGAATTCTTACCCTACACTGTTAACACT c AAAGAATTCTTAAACACTCCACTCATCACA d GTGTATCAGCAGAGAACACCGAAGACTGCATCGCC GGCGATGCAGTCTTCGGTGTTCTCTGCTGATACAC d GGGAAAATAGAGTGTGAATCAGCAGAGACCACC ... AAAGGATCCAAGGAAGCTTGCGTCCACAAGATA AAAGAATTCTTAGGCAGCCCTACCTCTGAGATTTT c AAAGAATTCTTAGGTGGTCTCTGCTGATACACACTC c AAAGAATTCTTAATGCAGTCTTCGGTGGTCTCT c AAAGAATTCTTACTTGCCCGCTATGTAGACAAA c AAAGAATTCTTAATCCTCACAATTATCGCTCTTATT ... AAAGGATCCATGAAGTGGTGTGCGCTGAG AAAGAATTCTTACAGGTGAGGTCAGAAGCTGATT AAAGGATCCAATTTTGCTGTAGCAGTGGTGAA AAAGAATTCTTAACCTGAAAGCGCCTGTGTAG AAAGGATCCCCCAACAACAAAGAGGGATACT AAAGAATTCTTAGGTGCTGCTGTTGACGTAATAT AAAGGATCCAAGGAAGCTTGCGTCCACAAGATA...
... it The Social Democrats became de facto guarantors of family capitalism because ofa surprising commonality of interests Social Democratic politicians wanted a stable large corporate sector controlled ... important there Japan’s variant of managerialism was a forced postwar transplant of American institutions In Canada, managerial capitalism displaced family groups through the first part ofthe 32 Randall ... Institute of Certified Public Accountants Angelo Melino, Canadian Economics Association Jeffrey M Perloff, American Agricultural Economics Association John J Siegfried, American Economic Association Gavin...
... ARVs and associated costs and total costs Year New cases starting ARVsa Total cases on ARVsa Total ARV diagnostic costs (ZAR million)b Total ARV drug costs (ZAR million )c Total plan costs (ZAR million)d ... Historical Currency Exchange Rates http://www.oanda.com/convert/fxhistory (Accessed June 2009) The yearly value was calculated by taking the daily interbank rate for each day in each year and averaged ... responses, particularly given the lack of financial commitment to achieve the rather modest goals The Treatment Action Campaign (TAC) was at the forefront of agitating for more resources to be pledged...
... of realistic operational scenarios and covering a number of conflicting figures of merit These two characteristics, large table of specifications and application of complex algorithms, make the design ... 264 specifications for ARTAS), an automatic procedure to search and tune the final solution is mandatory Classical techniques, such as those based on gradient descent, were discarded due tothe high ... performance for all components, and especially for the tracker systems which process radar data To this, it considers that the worst case of track performance will be expected in the case that a tracker...
... formula for PA (t) in [I] Let us define QA (t) by pA (t) = PA (t) + QA (t) From the partial fraction expansion above, it is clear that QA (and hence also pA ) is a quasi-polynomial, that is, an expression ... In the special case in which the are pairwise relatively prime, each PA,λ(t) for λ = is a constant, and thus QA (t) is a periodic function with average value 0, and this property determines QA ... by PA (t) and call the polynomial part of pA (t) It is easy to see that PA (t) is a polynomial of degree n − (More generally, the degree of PA,λ(t) is one less than the number of values of i...
... and those found in the other studies suggests that the cation exchange capacity ofthe cell wall was probably low Major inorganic solutes, K, PO and Cl, accounted for approximately half the cell ... that one or several cations were not taken into account One of them may be ammonium which cannot accumulate in the cytosol but could be present in the vacuole at high concentration (50 mM) as ... that potassium deficiency inhibits photosynthesis and reduces carbon availability in roots [6] According to Atzmon et al [3], in case ofa shortage of assimilates in the root system, the apical...