a hub protein that relays signals from nutrients growth factors and various stresses
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... SB123 and SB124 The mutants generated in this study are detailed in Table Bacterial strains, plasmids and growth conditions The bacterial strains and plasmids used in this study are detailed in Table ... proteins had 24% sequence similarity A crystal structure of Met8P has shown that this protein has an aspartate residue (Asp141), which is important for both chelatase and dehydrogenase function ... 42 kDa) with a C-terminal strep II tag could be found in the total cell lysate and the periplasmic fraction, but was absent from the membrane and cytoplasmic fractions (B) The same cell fractions...
- 12
- 613
- 0
Báo cáo khoa học: Cytosolic phospholipase A2-a and cyclooxygenase-2 localize to intracellular membranes of EA.hy.926 endothelial cells that are distinct from the endoplasmic reticulum and the Golgi apparatus pdf
... cPLA2 -a and convert arachidonic acid into prostaglandin H2 [8,9] To date, two distinct COX isoforms, COX-1 and COX-2, have been identified and characterized, and an alternative splice variant ... the calcium-induced relocation of cPLA2 -a in EA.hy.926 endothelial cells We show that cPLA2 -a relocates to intracellular membrane compartments that are distinct from the ER and the Golgi apparatus ... cells and HUVECs were compared Equivalent amounts of protein were separated by SDS ⁄ PAGE and immunoblotted for cPLA2 -a Lysates from the parental A5 49 cell line and HeLa cells were also analysed...
- 13
- 387
- 0
Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx
... vascular endothelial growth factor expression in endothelial cells and cardiac myocytes J Mol Cell Cardiol 33, 2179–2187 11 Tanaka, T., Kanai, H., Sekiguchi, K., Aihara, Y., Yokoyama, T., Arai, ... [26,27,42] and IRES-driven translation [43–46] it is possible that the CSD/PTB sites play a role in translation as well as stabilization of the VEGF mRNA A combined role in mRNA stability and translation ... single-strand RNA and DNA binding, cold shock domain (CSD) (also known as Y-box) proteins, play diverse roles in both transcriptional and post-transcriptional regulation of growth factor and stress...
- 13
- 604
- 0
Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot
... was obtained from Amersham International (Aylesbury, UK) X-ray films (X-OMAT-AR) were from Eastman Kodak (Rochester, NJ) Cells, cytokines and antibodies PC12 and COS-7 cells (ATCC, Manassas, VA, ... 3027 STAT3 and MAPK activation by Hyper-CNTF in transfected BAF/3 cells Downstream signal transduction pathways were analyzed by studying the activation level of JAK/STAT and MAP kinase signaling ... Phosphorylated STAT3 and p44/42 MAP kinases (New England Biolabs, Schwalbach, Germany), were detected using polyclonal rabbit anti-(phospho-STAT3) Ig and anti(phospho-p44/42 MAP kinase) Ig As secondary...
- 9
- 442
- 0
Báo cáo khoa học: Heteromer formation of a long-chain prenyl diphosphate synthase from fission yeast Dps1 and budding yeast pptx
... CGAATTCTTACTTTCTTCTTGT CAGTGAATTCGAGCTCGGTACCC ATACATACTGAATCATCATCTCCTTC GAG ATGATTCAGTATGTAT ATAAGGCGCATTTTTCTTCAAAGCTTTCAC TTCTTTCTCG to generate pBSSK-COQ1 For the expression of COQ1 in fission yeast, the ... functional expression in Escherichia coli and Saccharomyces cerevisiae J Bacteriol 179, 5992–5998 20 Okada K, Kainou T, Tanaka K, Nakagawa T, Matsuda H & Kawamukai M (1998) Molecular cloning and mutational ... Okada K, Kamiya Y, Zhu X, Tanaka K, Nakagawa T, Kawamukai M & Matsuda H (1997) Analysis of the decaprenyl diphosphate synthase (dps) gene in fission yeast suggests a role of ubiquinone as an antioxidant...
- 16
- 315
- 0
Báo cáo hóa học: " Dipolar cortico-muscular electrical stimulation: a novel method that enhances motor function in both - normal and spinal cord injured mice" pdf
... between ipsilateral and contralateral spinal responses was statistically significant (n = 15, p < 0.001, t-test) Stimulating M1 resulted in ipsilateral and contralateral spinal motoneuronal responses ... cortically-elicited spinal responses from the same animals revealed significant increase in both contralateral and ipsilateral (to stimulated M1) after dCMS *p < 0.05 Data show means ± SD Ahmed ... from intracellular recordings from sacrocaudal motoneurons that show a sustained and exaggerated firing rate in animals with SCI [48] Minutes after dCMS, motoneuronal spontaneous activity was still...
- 15
- 639
- 0
Setting up a new business requires hard work from the business founders and presidents.in your opinion,what things they should consider before setting up a new business
... goods and services All businesses must have capital in order to purchase assets and maintain their operations +Business capital comes in two main forms: debt and equity -The Importance of Capital: ... establishing a company, we can’t help caring about laws and regulations An nascent enterprise will have many problems, so we should prepare legislations to compare with what we are doing Law has ... lifestyle, attitude and their social class And have identified where the target audience is, you need to know: + Who are they, what will attract and appeal to them; +The number of people will fall into...
- 7
- 3,148
- 9
Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt
... 5¢-AAACCAGCCATGAATGAAAT-3¢) and with actin primers (forward primer: 5¢-GTTGGGAT GAACCAGAAGGA-3¢; reverse primer: 5¢-GAACCA CCGATCCAGACACT-3¢) as a control Reactions with no DNA added served as a ... promoter fragment The sequences of the oligonucleotides used for these experiments are: Oligo I, 5¢-CAAGGACGTTCGATGCA CTTCCAAAAAACATATAAT-3¢; Oligo II, 5¢-CAAT GTAGTATTAAAAAGTAGTAGTTAAAAGC-3¢; Oligo ... propose that p40 is a negative regulator of the CaM5 gene promoter that may act in a similar way to the DREAM protein, a negative transcriptional regulator that acts in a calcium-dependent manner...
- 12
- 365
- 0
How to setup a Linux system that can boot directly from a software RAID
... disks already contains data, make a backup if needed (all existing data of partitions involved in the process will be lost), and delete or resize existing partitions to create space for the software ... the partitioning utility to create the software RAID partitions In the example both disks are split into a 3498Mb and a 596Mb software RAID partitions: Device Type Size Mbytes /dev/hda1 software ... boot loader: Once the configuration installation options are provides, the installation of the system starts: Notice that while the system is installing, the software RAID transparently initializes...
- 14
- 567
- 1
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
... LlCBP3 3A was small and ceased after approximately 48 h (Fig 6A) This indicates that LlCBP3 3A only acts on a specic minor subfraction of a- chitin Thus, LlCBP3 3A has an effect on the degradation of a- chitin, ... Vaaje-Kolstad et al containing 100 lm of (GlcNAc)14 was analysed at the start, in the middle and at the end of each series of samples The resulting average values of the standards (displaying standard ... more neutral pH optima have an aspartic acid at this position For the latter type of enzyme, it has been shown that mutation of aspartic acid to asparagine leads to a drastic acidic shift of the...
- 14
- 683
- 0
Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc
... gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG Ccttctccccggcggttagtgctgagagtgc aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa Primer ... PCMV-Sport–b-gal plasmid) CGCTATTACCATGGTGATGC (nucleotides 4588–4608 of PCMV-Sport–b-gal plasmid) CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg ... β-gal AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’ (3) TOP-β-gal CMV Transcription start site β-gal Relative abundace of β-gal A PABP expression during heat shock recovery...
- 19
- 596
- 0
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf
... anti-GST and anti-Flag (Sigma), and anti-PARP (Cell Signal) The ProteoExtract Subcellular Proteome Extraction Kit (Calbiochem, La Jolla, CA, USA) was used to extract proteins from mammalian cells according ... band, and s-DAPK-1N29 8A ⁄ L29 9A (TM2) showed a weakened cleavage band (Fig 3B) These data suggest that the first two amino acids of the tail are critical for proteolytic susceptibility, and that ... mRNA level is depicted as a ratio of DAPK-1 ⁄ s-DAPK-1 to actin (E, F) s-DAPK-1, DAPK-1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA quantification in colon carcinoma and rectal carcinoma...
- 11
- 659
- 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf
... brassicae CSPMbraA6 [32] We observed also that BrC15-Ac was able to displace ASA, suggesting that brominated fatty acid and ASA both associated with W81 in the same ligand binding site The ligand ... Nomura, A. , Kawasaki, K., Kubo, T & Natori, S (1992) Purification and localization of p10, a novel protein that increases in nymphal regenerating legs of Periplaneta americana (American cockroach) ... analysis and purification of recombinant ASP3c (A) SDS/PAGE analysis of recombinant ASP3c secreted by Pichia pastoris Lane shows standards (Low range and Polypeptide kits, Bio-Rad, France) and lanes...
- 11
- 642
- 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 468/156 ... excised and purified with the GFXTM PCR DNA and Gel Band Purification Kit (AmershamPharmacia Biotech) Each p26 cDNA was ligated into pET21(+) using T4 DNA ligase, and competent E coli DH 5a were transformed...
- 10
- 495
- 0
Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx
... released PAD and ABL2 antigen (p75) on the oocyte's surface B and F are artificially activated oocytes treated with a high salt solution that removed PAD and p75 from oocytes' surfaces C and G are ... (red) and ABL2 (green) A and D show the LCA labeling in the zona pellucida (arrowhead) B and E show ABL2 labeling on the plasma membranes and in the subcortical region (arrow) of blastomeres G and ... (SignalP V2.0 and TargetP V1.0) [35-37] were used to determine that a putative signal peptide and a cleavage site exist in ePAD and AAH53724 (an egg and embryo abundant peptidylarginine deiminase),...
- 22
- 519
- 0
Báo cáo khoa học: A DmpA-homologous protein from Pseudomonas sp. is a dipeptidase specific for b-alanyl dipeptides Hidenobu Komeda and Yasuhisa Asano docx
... D-Ala-Gly, D-Ala-(Gly)2 (D-Ala)2, D-Ala-L-Ala (D-Ala)3 (D-Ala)4, L-Ala-Gly, L-Ala-(Gly)2 (L-Ala)2, L-Ala-D-Ala, L-Ala-D-Ala-L-Ala, DL-Ala-DL-Asn, DL-Ala-DL-Ile, DL-Ala-DL-Leu, DL-Ala-DL-Met, DL-AlaDL-Phe, ... L-Ala-pNA D-Ala-NH2 L-Ala-NH2 D-Ala-(Gly)2 L-Ala-(Gly)2 b-Ala-L-Ala b-Ala-Gly b-Ala-NH2 b-Ala-L-His (Carnosine) b-Ala-L-Leu (b-Ala)2 similarity to that from dmpA of O anthropi LMG7991 DmpA has ... of Ala-pNa and alaninamide as substrates by BapA was also comparable to that exhibited by DmpA The substrate specificity of BapA was however, different from that of DmpA with respect to the activity...
- 10
- 406
- 0
Báo cáo khoa học: Purification of a plant nucleotide pyrophosphatase as a protein that interferes with nitrate reductase and glutamine synthetase assays pdf
... purification (Fig and data not shown) The final fractions contained three protein bands with apparent molecular masses of 70, 47 and 45 kDa on SDS/PAGE that were most abundant in the fractions containing ... in a 100-lL incubation at 30 °C for 10 min, using the amounts and concentrations of ATP and NADH used in standard GS and NR assays, respectively Data are presented as mean ± SEM Cofactor AMP ... sequenced BLAST searches of sequence databases revealed that the band of 70 kDa belonged to the acyl-CoA oxidase protein family, while all of the peptides derived from the 47 and 45 kDa bands matched...
- 7
- 457
- 0
Báo cáo khoa học: NblA from Anabaena sp. PCC 7120 is a mostly a-helical protein undergoing reversible trimerization in solution pot
... Nakamura, Y., Wolk, C.P., Kuritz, T., Sasamoto, S., Watanabe, A. , Iriguchi, M., Ishikawa, A. , Kawashima, K., Kimura, T., Kishida, Y., Kohara, M., Matsumoto, M., Matsuno, A. , Muraki, A. , Nakazaki, ... predicts a similar helical arrangement for all of the analysed NblA sequences from cyanobacteria as well as red algae Thus, we propose that all NblA-homologous molecules identied so far share a common ... We have cloned the gene from Anabaena sp PCC 7120 and puried the protein without tags We show that NblA from Anabaena sp PCC 7120 is a mostly a- helical protein The results from the thermally...
- 8
- 308
- 0
Báo cáo khoa học: Brox, a novel farnesylated Bro1 domain-containing protein that associates with charged multivesicular body protein 4 (CHMP4) potx
... site-directed mutagenesis using pmGFP–Brox as a template and complementary primers (5¢-CAA AAG GAC ACT GGG TCC TAC ATC TCC TAA G-3¢ and 5¢-CTT AGG AGA TGT AGG ACC CAG TGT CCT TTT G-3¢) To create pStrep–BroxC408S ... Strep-tag II and pAb to FLAG) and secondary antibodies [Alexa Fluor 488-conjugated goat anti-(mouse IgG) and Cy3-labeled goat anti-(rabbit IgG)] The fluorescence signals of Alexa Fluor 488 (A, D, ... AAA GAC CCC AAC GAG AAG CGC GAT CAC-3¢ and 5¢-GTG ATC GCG CTT CTC GTT GGG GTC TTT GCT CAG CTT GGA CTG-3¢) pmGFP–Brox C408S , which has a point mutation at amino acid 408, was created by PCR-based...
- 11
- 412
- 0
Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc
... K., Takahashi, M., Sekine, M., Baba, S., Ankai, A. , Kosugi, H., Hosoyama, A. , Fukui, S., Nagai, Y., Nishijima, K., Otsuka, R., Nakazawa, H., Takamiya, M., Kato, Y., Yoshizawa, T., Tanaka, T., ... Natl Acad Sci USA 97, 14257–14262 49 Kawarabayasi, Y., Hino, Y., Horikawa, H., Yamazaki, S., Haikawa, Y., Jin-n., o, K., Takahashi, M., Sekine, M., Baba, S., Ankai, A. , Kosugi, H., Hosoyama, A. , ... bacteria Aquifex aeolicus, Thermotoga maritima and Thermoanaerobacter tengcongensis not encode a protein related to bacterial DsbA and no DsbA-like protein in Archaea were found, suggesting that...
- 12
- 506
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25