... αglucosidase and α-amylase can significantly reduce the post-prandial increase in blood glucose after a meal, with starch as the major calorie intake The apparent advantage of the starch hydrolase ... complementary to acarbose 2.3.1 Acarbose Acarbose is a pseudo-tetrasaccharide, because of its structural similarity to typical tetrasaccharides It is bio-synthesized by Actinoplanes, a type of bacteria ... process of starch involves saliva α-amylase, pancreatic αamylase, and the small intestinal brush border α-glucosidase, that is, maltaseamyloglucosidase and sucrase-isomaltase [19, 67] Determination...
... zero standard For direct capture this was found to be 13 ng/mL, for homogenous sandwich Assay 20 ng/mL and for the direct Sandwich Assay ng/mL An inter -assay, intra -assay precision profile analysis ... to a sample would take one hour turnaround To deliver a more rapid semi-quantitative assay from a blood sample, a simple, rapid ratio metric assay was thus performed A normalisation standard ... antibodies that are a potential interference in immunoassays [27-30] This initial CRP assay carried out using RAP assay was compared with a commercial, validated high sensitivity ELISA by analysing spiked...
... Ribav irin concentration microM Figure the AVINA amantadine against influenza A and B viruses in Titration of assay Titration of amantadine against influenza A and B viruses in the AVINA assay ... development of the AVINA assay, ahighthroughputassay that measures NA activity as a read-out for virus replication The advantages of this assay are its ease of execution, reproducibility, and sensitivity ... be administered therapeutically, making it a poor antiviral candidate The AVINA assay can be used in ahighthroughput format Final assay conditions were used in a blind screen of an ion channel...
... severe anaemia, in between that of thalassaemia minor and major, afflicts the patient This is termed thalassaemia intermedia Southeast Asia lies in the malaria belt where for thousands of years, malaria ... that causes β-thalassaemia syndromes This was one of the research areas in our laboratory for many years and a large number of samples with known mutations of the β-globin chain are available Another ... liquid-phase assay formats, a feasible solution is to design the minisequencing assay on the solid phase, for example, on the DNA chip platform Solid-phase assay formats In solid-phase assay formats, oligonucleotide...
... rescence assay is approximately 10–30 times more sensitive than the standard gel assayfor measuring this activity In addition, the assay is much faster than gel analysis and numerous samples can be ... incubation Figure activity Moderate -throughput solution assayfor integrase joining Moderate -throughput solution assayfor integrase joining activity Panel A Principles of a solution assay to measure ... Proc Natl Acad Sci USA 2002, 99:6661-6666 Asante-Appiah E, Skalka AM: A metal-induced conformational change and activation of HIV-1 integrase J Biol Chem 1997, 272:16196-16205 Katz RA, DiCandeloro...
... The Z-factor provides an easy and useful measure forassay quality and has been a widely accepted standard Z-factor reflects both the assay signal dynamic range and the data variation associated ... limit than a heterogeneous, two-step flow-based assay Completely homogeneous assays are advantageous in that they allow single step, rapid tests that require minimal amounts of sample and are easier ... the assay performance may be increased by using more massive, larger diameter amplification particles such as gold nanoparticles Homogeneous and semi-homogeneous assay with nanoparticle enhancement...
... operates AxioVision via its optionally available Visual Basic for Applications (VBA) interface This script program also provides a graphical user interface where the experimenter parametrizes and ... considered 0.5 automated 0.4 0.3 0.2 0.1 0 0.1 0.2 0.3 manual 0.4 0.5 Figure Correlation between manual and automated analysis Correlation between manual and automated analysis In this evaluation, 45 ... [25] We randomly partitioned the data set and used one half for training the classifier and the other half for testing To obtain a stable informational value, this partitioning, training, and testing...
... Srigungsitthisunti, and Xu: Ridge aperture antenna array as ahigh efficiency coupler Fig Results for an aperture array defined by a = 750 nm (a) Reflection from aperture array in comparison to a bare silicon ... Srigungsitthisunti, and Xu: Ridge aperture antenna array as ahigh efficiency coupler Fig Absorption enhancement in silicon compared with that without the aperture array in near-IR is near zero if no antenna array ... Srigungsitthisunti, and Xu: Ridge aperture antenna array as ahigh efficiency coupler R A Pala, J White, E Barnard, J Liu, and M L Brongersma, “Design of plasmonic thin-film solar cells with broadband absorption...
... Srigungsitthisunti, and Xu: Ridge aperture antenna array as ahigh efficiency coupler Fig Results for an aperture array defined by a = 750 nm (a) Reflection from aperture array in comparison to a bare silicon ... Srigungsitthisunti, and Xu: Ridge aperture antenna array as ahigh efficiency coupler Fig Absorption enhancement in silicon compared with that without the aperture array in near-IR is near zero if no antenna array ... Srigungsitthisunti, and Xu: Ridge aperture antenna array as ahigh efficiency coupler R A Pala, J White, E Barnard, J Liu, and M L Brongersma, “Design of plasmonic thin-film solar cells with broadband absorption...
... Kafri (University of North Carolina, Chapel Hill, NC, USA) for providing pcDNA VSV-G, Dr H Sakai (Shinshu University, Nagano, Japan) for help with statistical analyses, and Dr T 10 Takeshita ... thank the Instrumental Analysis Research Center for Human and Environmental Science at Shinshu University for technical assistance with DNA sequencing and flow cytometric analyses This work was ... T, Asao H, Ohtani K, Ishii N, Kumaki S, Tanaka N, Munakata H, Nakamura M, Sugamura K: Cloning of the gamma chain of the human IL-2 receptor Science 1992, 257:379-382 Noguchi M, Yi H, Rosenblatt...
... Retinal Retinal & acetaldehyde Acetaldehyde 10-Formyltetrahydrofolate 10-Formyltetrahydrofolate y-Aminobutyraldehyde Succinate semialdehyde Retinal Malonate semialdehyde Aromatic & Aliphatic Aldehydes ... esterase assay utilized 0.97 mM para-nitrophenylacetate as a standard substrate concentration and enzyme concentration of 0.06 uM for ALDH2 and 2% (v/v) DMSO in all assay conditions The activity ... substrate and available X-ray crystal structure deposition code from the Research Collaboratory for Structural Bioinformatics (RCSB) database (114, Adapted from Strickland et al., 2011) Gene Name ALDH 4A1 ...
... Fodor et al.10 and Brown and colleagues,11,12 and has led to the DNA microarray revolution DNA microarrays are pervasively used today in a wide range of applications, spanning both research and industry, ... KDKD Caspase-3 521 Caspase-3 Caspase-7 440 Caspase-7 200 0 1000 2000 3000 500 R2 R2 0.97 0.97 4000 Caspase-3 Caspase-7 KDKD Caspase-3 565 Caspase-3 Caspase-7 600 Caspase-7 Caspase-3 Caspase-7 ... Fluorescence Polarization Assay 118 6.5.3 Inhibition Assay against PTPs 118 6.5.4 Ca2+-actived Protease Assay 120 6.5.5 Screening for Inhibition Activity against Caspases 120 6.5.6 IC50 Measurements...
... technology platform With microarrays, this is attributed to significant advantages rooted in miniaturization, parallelization and automation Breaking away from microtiter-based (or well-based) assays, ... platforms for rapid screening, lead discovery and molecular characterization The essential advantages of microarray and microplate technology are attributed to the massive throughput attainable, ... sub-nanolitre quantities of reagents, and may become available in the near future.20 Various instruments have also enabled a variety of parameters to be analyzed in high- throughput using microplates...
... International Conference on Advanced Computer Science Applications and Technologies, IEEE [3] Mohamed Khalil Hani, Hau Yuan Wen, Arul Paniandi, “Design and Implementation of a Private and Public ... propose to use carry save adders (CSA) to calculate the intermediate values and ripple carry adder to calculate the final result The hierarchical CSA tree is shown in the Figure In this architecture, ... encrypted by the RSA algorithm, and there is no key establishment separately before data transferring We can change the secret key at anytime without key re-establishment as in traditional cryptosystem...
... Biotin-TCGACTAGAAGCTTCTAGAAGCTTCTAG AGCTGATCTTCGAAGATCTTCGAAGAT Biotin-TCGACTTCAAGCTTGTACAAGCTTGTAG AGCTGAAGTTCGAACATGTTCGAACATC Biotin-AACGACGGTCGCTCCGCCTGGCT nM Unlabeled HSE DNA- binding activity ... confirm that the assay specifically measures HSF1 DNA- binding activity Analytical range and precision The analytical range of the assay was evaluated using known concentrations of recombinant human HSF1 ... temperature Assay procedure The assay was run as a three-step assay: initial incubation of the sample and probe, addition and incubation of the sample and acceptor beads in the plate wells, and addition...
... 101–103 2094 A V Antonov et al 33 Okuda S, Yamada T, Hamajima M, Itoh M, Katayama T, Bork P, Goto S & Kanehisa M (2008) KEGG atlas mapping for global analysis of metabolic pathways Nucleic Acids Res ... reactions that share the same compounds In general, a reaction consists of multiple reactant pairs, and the one that appears in a KEGG metabolic pathway is called a main pair To build a global ... a great demand for bioinformatics to provide a statistically valid interpretation of compound lists produced experimentally Currently, several bioinformatics approaches are available for metabolomics...
... endogenous human Argonautes and their miRNA partners in RNA silencing Proc Natl Acad Sci USA 2008, 105:7964-7969 33 Katayama S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M, Nishida H, Yap CC, ... default values used in this analysis are summarized in Table S1 in Additional file The software for miRTRAP and other resources are available on our website [49] Additional material Additional ... Kawai J, Suzuki H, Carninci P, Hayashizaki Y, Wells C, Frith M, Ravasi T, Pang KC, Hallinan J, Mattick J, Hume DA, Lipovich L, Batalov S, Engstrom PG, Mizuno Y, Faghihi MA, Sandelin A, Chalk AM,...
... MasterScan: a database of shotgun mass spectra The MasterScan is a flat file database that stores all mass spectra acquired from all analyzed samples, including technical and biological replicates, ... available for testing local installations of the software LipidXplorer benchmarking: the dataset E coli total lipid extract was purchased from Avanti Polar Lipids (Alabaster, AL, USA) and analyzed ... demonstrated that LipidXplorer takes full advantage of the high mass resolution and mass accuracy of a hybrid tandem mass spectrometer It has also become apparent that averaging and alignment of related...
... the automated workstation For each SELEX, μM of the RNA library was heated at 80°C for min, cooled at 4°C for min, placed at room temperature for and mixed DNA primers and the biotinylated DNA anchor ... Mairal T, Cengiz Ozalp V, Lozano Sanchez P, Mir M, Katakis I, O’Sullivan CK: Aptamers: molecular tools for analytical applications Anal Bioanal Chem 2007, 390:989-1007 Dausse et al Journal of Nanobiotechnology ... molecules are also of high potential value in medicine [13] as for instance an anti-VEGF aptamer has been recently approved by the Food and Drug Administration for the treatment of age-related macular...