a class b or class c block of addresses classless addressing assigns an organization a block of contiguous addresses based on its needs
Theory of nonequilibrium transport based on a class of chaotic fluctuations
... physical system, is crucial to the characteristics and behavior of the chaotic fluctuation At the level of macroscopic chaotic fluctuations, hydrodynamic fluctuations rein with an arbitrarily long wavelength ... present a < /b> mathematical theory on the transport of mesoscopic particle under the action of a < /b> class < /b> of nonequilibrium chaotic fluctuations By considering a < /b> perturbative Perron-Frobenius approach, we arrive ... days), are all chaotic in the macroscopic scale of celestial objects At the scale of living things, macroscopic chaos are found everywhere within chemical, hydrodynamical, biological, mechanical and...
- 130
- 262
- 0
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx
... Sinibaldi et al Anion-modulated structure of cyt c A-< /b> state B C D Absorbance at 395 nm A < /b> Fig (A)< /b> Static absorption spectra of acid-denatured ferricytochrome c (spectrum a)< /b> , of the K88 ⁄ T89KE double ... kinetics of acid-denatured cytochrome c is biphasic (Fig 8B) ; also, the K88E ⁄ T89K double mutant shows biphasic behavior, but in this case the fast phase is faster and the absorbance change weaker ... is characterized by a < /b> slight increase of the absorbance band centered at 528 nm and by a < /b> blue-shift of the CT band from 618 to 616 nm (spectrum b of Fig 8A)< /b> The slow phase is instead characterized...
- 11
- 487
- 0
Thermal error modelling of machine tools based on ANFIS with fuzzy c means clustering using a thermal imaging camera
... a < /b> personal computer for analysis In this work, the data has been analysed using MATLAB One disadvantage of thermal imaging is it can have low absolute accuracy, usually in the order of ± C A < /b> ... 5.0802 Table The characteristics of the FCM-ANFIS models Model FCM-ANFIS FCM-ANFIS FCM-ANFIS FCM-ANFIS FCM-ANFIS FCM-ANFIS FCM-ANFIS FCM-ANFIS No of inputs No of MFs for each input No of iterations ... because of the problems of establishing the boundary conditions and accurately obtaining the characteristics of heat transfer The second approach uses empirical modelling, which is based on correlation...
- 17
- 818
- 0
Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt
... (AGCAGGAC20aA) and 10 nucleotides (AGCCA17aGGAC20aA), respectively The P horikoshii tRNAArgCCU gene (5¢-GGACCGGTAG CCTAGCCA17aGGAC20aAGGGCGGCGGCCTCCTAAG CCGCAGGTCCGGGGTTCAAATCCCCGCCGGTCCG CCA-3¢) was ... the ATP–PPi exchange reaction, the Arg-NHOH formation reaction, and the deacylation reaction (A)< /b> Arg (cyan), ATP (orange) coordinated by Mg2+ and A7< /b> 6 (green) of tRNA assisting the Arg-AMP formation ... form aminoacyl-tRNA In the aminoacylation reaction of class < /b> I aaRSs with aminoacyl-AMP, the 2¢-OH group of the ribose of A7< /b> 6 tRNA attacks the carbonyl carbon atom of the –Ca–(CO)–O– moiety of...
- 17
- 512
- 0
Báo cáo khoa học: A new clan of CBM families based on bioinformatics of starch-binding domains from families CBM20 and CBM21 potx
... CGTase cgtBacci2 CGTase cgtBacci8 CGTase cgtBacciA CGTase cgtBaccl CGTase cgtBacli CGTase cgtBacma1 CGTase cgtBacma2 CGTase cgtBacoh CGTase cgtBacsp0 CGTase cgtBacsp1 CGTase cgtBacsp7 CGTase cgtBacsp3 ... cgtBacsp3 CGTase cgtBacsp63 CGTase cgtBacsp6 CGTase cgtBacspB CGTase cgtBacspD CGTase cgtBacspE CGTase cgtBacspK CGTase cgtBacst CGTase cgtGeost CGTase cgtKlepn CGTase cgtThmth CGTase cgtThcsp cgt_Bacsp5 ... n.d Bacillus agaradhaerens Bacillus brevis Bacillus circulans 251 Bacillus circulans Bacillus circulans A1< /b> 1 Bacillus clarkii Bacillus licheniformis Bacillus macerans Bacillus macerans Bacillus...
- 17
- 476
- 0
Báo cáo khoa học: "Towards a Semantic Classification of Spanish Verbs Based on Subcategorisation Information" doc
... Probability and Mathematical Statistics Jonh Wiley and Sons, Inc., New York Anna Korhonen 200 2a < /b> Semantically motivated subcategorization acquisition In Proceedings of the Workshop of the ACL ... Proceedings of the Seventh Conference on Natural Language Learning (CoNLL-2003), page , Edmonton/Canada Gloria V´ zquez, Ana Fern´ ndez, Irene Castell´ n, a < /b> a o and M Antonia Mart´ 2000 Clasificaci´ n ... subcategorization dictionary from corpora In Proceedings of the 31st Annual Meeting of the ACL, pages 235–242, Columbus/Ohio Paola Merlo and Suzanne Stevenson 2001 Automatic verb classification based on statistical...
- 6
- 418
- 0
Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx
... no constraint on the scoring function because it only scores final states Note that the branching factor with a < /b> paraphrase table can be around thousand actions per states which makes the generation ... paraphrases Colin Bannard and Chris Callison-Burch 2005 Paraphrasing with bilingual parallel corpora In Annual Meeting of ACL, pages 597–604, Morristown, NJ, USA Association for Computational Linguistics ... action We impose the constraint that any transformed part of the source sentence cannot be transformed anymore This paradigm is more approriate for paraphrase generation than the standard SMT approach...
- 4
- 338
- 0
Báo cáo khoa học: "A FLEXIBLE NATURAL LANGUAGE PARSER BASED ON A TWO-LEVEL REPRESENTATION OF SYNTAX" ppt
... Interpretation of Natural Lan guage Commands Proc.7th IJCAI, Vancouver B. C (198 1a)< /b> , 440-442 Lesmo L., Magnani D., Torasso P.: Lexical and Pra~ matic Knowledge for Natural Language Analysis Proc IEEE ... lectional restrictions stored in the net, the actu al role of the filler of each case (e.g syntactic subject or syntactic object) ($7) DI a < /b> quel ragazzo che pesca fantastica hai fatto (Tell that ... checks nor the actual translation of the query are done at the end of the syntactic analysis; in fact the semantic checks are performed when a < /b> node is filled with a < /b> content word and the translation...
- 8
- 412
- 0
sensitivity properties of a novel no2 gas sensor based on mesoporous wo3 thin film
... pattern of mesoporous WO3 thin films calcined at 250 ◦ C for h indicating that this crystallographic nucleation actually occurs during the calcination, but is limited to formation of nanocrystallite ... Science and Engineering from National Cheng Kung University, Tainan, Taiwan in 1995, 1997 and 2002, respectively He is now an associate researcher at National Nano Device laboratories Hsinchu, Taiwan ... polycrystalline conductors, grain boundaries contribute most of the resistance The surface resistivity of an oxide crystal depends on the electron concentration near the surface, which in turn is affected by...
- 7
- 499
- 0
Báo cáo khoa học: "Are These Documents Written from Different Perspectives? A Test of Different Perspectives Based On Statistical Distribution Divergence" ppt
... issue about the Israeli-Palestinian conflict is selected for discussion (e.g., “Disengagement: unilateral or coordinated?”), and a < /b> Palestinian editor and an Israeli editor each contribute one article ... summarization based on minimum cuts In Proceedings of the Association for Computational Linguistics (ACL-2004) Bo Pang, Lillian Lee, and Shivakumar Vaithyanathan 2002 Thumbs up? Sentiment classification ... two document collections, A < /b> and B, and then measure the degree of contrast by calculating the “distance” between A < /b> and B How document collections are statistically modeled and how distribution difference...
- 8
- 366
- 0
báo cáo hóa học: " A new definition of burnout syndrome based on Farber''''s proposal" pptx
... practice Paper presented at the Annual Conference, American Psychological Association San Francisco; 2001 McKinney M: Tipolog a < /b> constructiva y teor a < /b> social (Spanish translation of Constructive ... also be explained by a < /b> background of prior learning within an organization managed with bureaucratic rules and demands, with an organizational system that does not rec- Page of 17 (page number ... contradiction, contrariness and the ability to be complementary, which are based on simple operations of assertion and negation, and by means of which the relation of reciprocal presupposition...
- 17
- 604
- 0
Báo cáo hóa học: "Fabrication of Densely Packed AlN Nanowires by a Chemical Conversion of Al2O3 Nanowires Based on Porous Anodic Alumina Film" potx
... FE-SEM images of densely packed alumina nanowires produced by chemical etching of the porous alumina film in diluted NaOH solution: a < /b> lowmagnification; b highmagnification Scale bar a < /b> 20 lm and b lm ... Summary and Conclusions Fig FE-SEM image of close-packed AlN nanowires obtained by chemical conversion of the alumina nanowires shown in Fig Scale bar lm We have developed a < /b> convenient method for ... exhibits an almost perfect, hexagonal closely packed, cylindrical pore arrangement with a < /b> uniform diameter and a < /b> pore interval Its average pore diameter and interval are *60 and 120 nm, respectively...
- 4
- 269
- 0
Báo cáo hóa học: " Research Article A Multiuser MIMO Transmit Beamformer Based on the Statistics of the Signal-to-Leakage Ratio" doc
... MIMO channel for each subcarrier can be considered to be a < /b> flatfading channel Considering that all users can access a < /b> given subcarrier and that the lengths of channel impulse responses for all receive-transmit ... [14] A < /b> Shah and A < /b> M Haimovich, “Performance analysis of maximal ratio combining and comparison with optimum combining for mobile radio communications with cochannel interference,” IEEE Transactions ... space-time block coding based on channel correlations,” IEEE Transactions on Information Theory, vol 49, no 7, pp 1673–1690, 2003 [19] M Chiani, M Z Win, and A < /b> Zanella, On the capacity of spatially correlated...
- 10
- 317
- 0
Báo cáo hóa học: "Fabrication of a Highly Sensitive Chemical Sensor Based on ZnO Nanorod Arrays" doc
... sensor measured at different O2 concentrations b Sensitivity versus O2 concentration c Dynamic resistance changes by successive increase in O2 concentration Fig a < /b> Resistance change in a < /b> ZnO NRA chemical ... 19 P Parthangal, R Cavicchi, M Zachariah, A < /b> universal approach to electrically connecting nanowire arrays using nanoparticles— application to a < /b> novel gas sensor architecture Nanotechnology 17, ... any considerable dislocations or stacking faults, meaning that the interfacial ZnO layer is of an epitaxial quality and that the individual ZnO nanorods are actually defect-free single crystals...
- 7
- 319
- 0
Báo cáo hóa học: " A Complete Image Compression Scheme Based on Overlapped Block Transform with Post-Processing" pptx
... the DCT and GenLOT in a < /b> parallel manner by taking advantage of the block transformation characteristics, one can see that the DCT and GenLOT can be very efficient As can be seen from Table and Figure ... transform and wavelet transform The waveform transform is used for the DC band and overlapped block transforms are used for other bands The advantage is the enhanced capability of capturing and ... quality at low bit rates, and then exploit the correlation across the subbands by an elegant combination of scalar quantizers and bit-plane entropy coders Global information is taken into account...
- 15
- 327
- 0
Báo cáo hóa học: " Computationally Efficient Direction-of-Arrival Estimation Based on Partial A Priori Knowledge of Signal Sources" ppt
... only needs the forward recursion of the MSWF to find a < /b> subspace of interest and use that subspace to calculate a < /b> reduced-rank data matrix and a < /b> reducedrank weight vector for a < /b> reduced-rank autoregressive ... computational cost than the classical MUSIC algorithm especially in the case of a < /b> large array Numerical results indicate that the proposed method surpasses the classical MUSIC estimator for the case ... basis vectors for the signal subspace and the noise subspace, the new signal subspace is capable of capturing the signal information while excluding a < /b> large portion of the noise On the contrary,...
- 7
- 221
- 0
Báo cáo khoa học: "A high density genetic map of maritime pine based on AFLPs" pps
... E+ACAA/M+CCGC 24 E+ACAA/M+CCCA 25 E+ACAA/M+CCGA 26 E+ACAA/M+CCTT 27 E+ACAA/M+CCTG 28 E+ACAA/M+CCAG 29 E+ACAA/M+CCAT 30 E+ACAC/M+CCAA 31 E+ACAC/M+CCAT 32 E+ACAC/M+CCTA 33 E+ACAC/M+CCTT 34 E+ACAC/M+CCTC ... E+ACAC/M+CCAG 36 E+ACAC/M+CCAC 37 E+ACAG/M+CCTG 38 E+ACAG/M+CCTA 39 E+ACAG/M+CCAT 40 E+ACAG/M+CCAA 41 E+ACAG/M+CCGA 42 E+ACAG/M+CCTC 43 E+ACAG/M+CCGT 44 E+ACAG/M+CCGC 45 E+ACAT/M+CCAG 46 E+ACAT/M+CCTA ... genetic map and number of polymorphic fragments PEC E+ACA/M+CCAG E+ACA/M+CCGA E+ACG/M+CCGC E+ACG/M+CCAG E+ACG/M+CCGT E+ACG/M+CCTA E+ACG/M+CCCA E+ACG/M+CCAA E+ACG/M+CCTG 10 E+ACC/M+CCAG 11 E+ACC/M+CCTG...
- 10
- 502
- 0
Báo cáo khoa học: "A comparison of daily representations of canopy conductance based on two conditional timeaveraging methods and the dependence of daily conductance on environmental factors" ppsx
... a < /b> calculation an average, stand transpiration based on sap flow data from a < /b> range of tree sizes Rather, each tree would were a < /b> C, day G ground -based have to have its own conductance calculation, ... conductance, both spatially and temporally, remains a < /b> subject of active research In temporal representations of canopy conductance, the daily time scale is particularly important Many climate or ... compared both arithmetic mean con- from our ductance, , C, diu G and conductance based daily means, G to a < /b> mean conducC,day weighted by above-canopy PAR (representing available energy) Figure demonstrates...
- 19
- 315
- 0
Báo cáo y học: " A single dose of DNA vaccine based on conserved H5N1 subtype proteins provides protection against lethal H5N1 challenge in mice pre-exposed to H1N1 influenza virus" ppt
... vaccines, DNA vaccine has lots of advantages It induces balanced immune responses and can be prepared in a < /b> short time and on a < /b> large scale, with high purity and stability [23] It seems that DNA ... Lacy KE, Gluckman SJ, Bagarazzi ML, Chattergoon MA, Baine Y, Higgins TJ, Ciccarelli RB, et al: First human trial of a < /b> DNA -based vaccine for treatment of human immunodeficiency virus type infection: ... administration of M2 -based vaccine with chitosan as an adjuvant Arch Virol 2010, 155:535-544 14 Kreijtz JH, Bodewes R, van den Brand JM, de Mutsert G, Baas C, van Amerongen G, Fouchier RA, Osterhaus AD,...
- 9
- 380
- 0
Báo cáo khoa học: " A simple and rapid Hepatitis A Virus (HAV) titration assay based on antibiotic resistance of infected cells: evaluation of the HAV neutralization potency of human immune globulin preparations" potx
... antibodies The absorbance values of all the dilutions of the negative control plasma were above the cutoff indicating the absence of anti-HAV antibodies Evaluation of anti-HAV neutralizing antibodies ... TMB substrate was added and color development was stopped by acidification Absorbance at 450 nm was measured in an ELISA plate reader Wells that developed at least times the absorbance of mock-infected ... titration assay based on the selection of blasticidin-resistant cells, and used this assay to evaluate the HAV neutralization potency of commercially available human IG preparations Results Titration...
- 9
- 297
- 0
- 17 match one of two alternatives based on a condition
- taxes settlement of which is based on profit or losses calculated in accordance with applicable tax standards
- a bayesian framework for improving clustering accuracy of protein sequences based on association rules
- for better or worse the impact of the veterinarian service on the development of the agricultural society in java indonesia in the nineteenth century
- or the c equivalent of the quot do over quot
- 3 detection of epoxy resin based on bisphenol a
- a new generation of chemical sensors based on mips
- emologus—a compositional model of emotion detection based on the propositional content of spoken utterances
- a post labeling approach for the characterization and quantification of rna modifications based on site directed
- the max option no b labels are necessary a bounding box is created based on the composite sizes and locations of all three images
- the method called getarea returns the area of a circle object based on its radius property
- 3 barker r m pucket j a design of highway bridges based on aashto lrfd bridge design specifications 2007
- 2 barker r m pucket j a design of highway bridges based on aashto lrfd bridge design specifications 2007
- atomic masses of the elements based on c 12
- magde e l elson and w w webb 4 to monitor the binding reaction between ethidium bromide and dna the principle of fcs is based on detecting fluorescence fluctuations as fluorescent particles diffuse in a
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25