7 these equations are extracted using a quasi static analysis of the coupled microstrip line structure which permits obtainin
Tunable ferroelectric thin film devices for microwave applications
... calculated from the capacitance of the capacitor, and the loss factor of the thin film is estimated from the quality factor of the capacitor The two important aspects of this method are the capacitor ... (b) The side view of a parallel plate varactor (c) The photograph of top view of a varactor 82 Figure 4.3 The matching impedance of phase shifter circuit as a function of capacitance of shunt varactor ... equivalent circuit of the parallel plate varactor 49 Figure 3.5 The simulated and measured real and imaginary parts of the S11 parameters of the varactor 50 Figure 3.6 Frequency dependencies of capacitance...
- 150
- 478
- 0
Vector sum phase shifter using a quadrature magic t for application in polarization control
... Polarization of antenna The EM wave used for either communication or radar is transmitted through an antenna The polarization of the EM wave is dependent on the polarization of the antenna Antenna ... H, are orthogonal to each other and are always perpendicular to the direction of wave propagation The polarization of uniform plane waves is defined as the direction of the time varying behavior ... antenna Fig 1-2: Dual linear polarization horn antenna Fig 1-3: Circular polarization spiral antenna Fig 1-4: Dual linear polarization array taken from [7] It is important to note that the dual linear...
- 144
- 238
- 0
Tài liệu Category 6 and 5e Dynamic Angle Right/Left Patch Panels pptx
... Specifications published here are current as of the date of publication of this document Because we are continuously improving our products, ADC reserves the right to change specifications without ... notice At any time, you may verify product specifications by contacting our headquarters office in Minneapolis ADC Telecommunications, Inc views its patent portfolio as an important corporate asset ... = Orange Spec Sheet Specifications Performance: Applications Supported: Front Interface: Rear Interface: Weight: Rack Mounting: Safety: Operating Temperature: Storage Temperature: EIA/TIA 568-B...
- 2
- 288
- 0
Tài liệu Báo cáo khoa học: The Alzheimer b-peptide shows temperature-dependent transitions between left-handed 31-helix, b-strand and random coil secondary structures doc
... two state interpretation of the CD data These values of Tm appear to fall near the minima of the / angle curves For comparison we also studied the variant peptide Ab(1228)G19G20 At low temperature, ... concentrations The pH was adjusted using phosphate buffer and was measured using a standard pH-meter The sample preparation was carried out at C and the samples were kept at low temperature until the ... into b -structure, the favoured secondary structure of the aggregates The central segment 1824, which has a large contribution of b-strand already at the low temperatures may be considered as the...
- 12
- 287
- 0
transmission line matrix (tlm) in computational mechanics - d. de cogan, et al., (crc, 2006) ww
... capacitance and has units (Farads) One of the simplest geometries is an arrangement of two parallel plates of area (A) , separated by a distance (L) in vacuum The capacitance is then expressed as ... either variable can be obtained The proportionality “constants” in the two first-order equations, such as ρ and κ above, are another pair of variables that typically arise in wave phenomena These ... concepts are now considered Generally, in phenomena to which the wave equation applies it is found that there are two physical variables that can be associated with the wave Each of these variables,...
- 275
- 514
- 0
Báo cáo hóa học: " Efficient implementation of 90° phase shifter in FPGA" pptx
... gate) 7 Adder/subtractor 24 Page of converter The phase shifts obtained are 90 .7 , 89.98°, and 89 .73 °, respectively The data from FPGA are captured in the PC and visualized in MATLAB The phase ... Figure and they agree with each other Hardware architecture The proposed hardware architecture is shown in Figure The architecture consists of two basic blocks: coefficient add/sub and tap adder The ... negative coefficient implementation and this reduces the hardware cost compared to the convectional implementation of the filter with CSD coefficients A comparison of the hardware cost for the...
- 5
- 303
- 0
Báo cáo nghiên cứu khoa học: " FAST CALCULATING FORMULAS OF CURRENT PASSING THROUGH GROUNDING SYSTEM OF HIGH VOLTAGE SUBSTATION WHEN LIGHTNING STRIKES AT THE GROUNDING WIRE OF TRANSMISSION LINE" pps
... into one then this equivalent twoterminals network will have the characteristic matrix as follows: ATD = A1 × A2 ×K × An = An (A 1) Appling the Caylay-Hamilton theorem to solve (A 1), we have: ⎡ ... equivalent circuit and use characteristic matrix method If we consider elementary parameters of each span to be equal, then each T -circuit will be considered as a two-terminals network having the ... Trang 37 Science & Technology Development, Vol 11, No.09 - 2008 2.3 Summary From the above analysis, we have a method to calculate the current value passing through the grounding system impedance...
- 8
- 451
- 0
Báo cáo y học: "Acute pressure overload of the right ventricle. Comparison of two models of right-left shunt. Pulmonary artery to left atrium and right atrium to left atrium: experimental study" doc
... always shorter than the RA-LA graft The pressure gradient PA-LA is always higher than the RA-LA These two issues constitute an inherent advantage of PA-LA shunt and are rendering PA-LA shunt more ... directly from each cardiac chamber at 10 and 20 minutes from the baseline Statistical Analysis Data is expressed as mean ± standard deviation (S.D.) or median (in case of violation of normality) for ... continuous variables and as percentages for categorical data The Kolmogorov - Smirnov test was utilized for normality analysis of the parameters The comparison of variables at each time point was performed...
- 10
- 337
- 0
Broadband phase shifter design for phased array radar systems
... and phased array receiver with N paths The antenna elements are placed apart from each other at a distance d When an incident signal reaches an antenna element under an angle θ, the time delay ... parasitics of the switching components are absorbed rather than avoided in the FET-integrated designs The ON state of the FET can be modeled by a small resistor and the OFF state of the FET can ... of the topology and the parasitics of the components It is also caused by the mismatch between the adjacent loads The loads can be for example the SPDT switches, the adjacent phase bits or other...
- 199
- 297
- 0
Transmission line and and waveguide
... dependent, Laplace’s Equation TEM Wave (Cont.) Electric field can be expressed as the gradient of a Scalar potential also satisfies Laplace ‘s equation The voltage and current Wave Impedance 10 Procedure ... TE, and TM Waves Parallel Plate Waveguide Rectangular Waveguide Circular Waveguide Coaxial Line Surface Waves on a Grounded Dielectric Sheet Stripline Microstrip Line The Transverse Resonant ... Outline 47 General Solutions for TEM, TE, and TM Waves Parallel Plate Waveguide Rectangular Waveguide Circular Waveguide Coaxial Line Surface Waves on a Grounded Dielectric Sheet Stripline Microstrip...
- 67
- 226
- 0
Báo cáo hóa học: " Research Article Blind Deconvolution in Nonminimum Phase Systems Using Cascade Structure" pptx
... average of 100 trails Figure illustrates the comparison results of the three algorithms It shows that the performances of PFD and NG are similar, and both of them are better than FD algorithm That ... find the MISI fluctuates at the initiation in FD algorithm due to the error back propagation In PFD algorithm, we use scalar anticausal filter in PFD and then avoid the error back propagation So the ... several easy subtasks The structure of demixing model is permutable because an anticausal scalar FIR filter is used 8 EURASIP Journal on Advances in Signal Processing Natural gradient-based algorithms...
- 10
- 229
- 0
microwave circuit modeling using electromagnetic field simulation
... example Internally, the software would use analytical equations to convert our physical dimensions to impedances and electrical lengths The software might use a Y-matrix, a cascade of ABCD parameter ... accurate than a combination of individual analytical models We could also optimize the termination, then use the analysis data and the Via hole Resistor Figure 2.12 A MoM analysis of a group of discontinuities ... examples from each of the major software packages This was perhaps a worthy but not very practical goal The reality is that I have used design examples that span more than a decade in time and...
- 488
- 730
- 0
Báo cáo sinh học: " Multivariate Bayesian analysis of Gaussian, right censored Gaussian, ordered categorical and binary traits using Gibbs sampling" pptx
... Simulated data The simulated data consist of records on five-thousand animals First the complete data consisting of a Gaussian, a right censored Gaussian, an ordered categorical, and a binary trait are ... greater than one) The outline of the paper is the following: in Section 2, a fully Bayesian analysis of an arbitrary number of Gaussian, right censored Gaussian, ordered categorical and binary traits ... number of Gaussian, right censored Gaussian, ordered categorical (more than two categories) and binary traits For example in dairy cattle, a four-variate analysis of a Gaussian, a right censored Gaussian,...
- 25
- 166
- 0
Supported group II transition metal catalysts in liquid phase reactions using borrowing hydrogen methodology 2
... Declaration I hereby declare that this thesis is my original work and it has been written by me in its entirety, under the supervision of Prof Stephan Jaenicke, (in the laboratory catalysis lab ... S5-04-04 and S5-02-02), Chemistry Department, National University of Singapore, between August 2008 and December 2012 I have duly acknowledged all the sources of information which have been used in the ... the thesis This thesis has also not been submitted for any degree in any university previously The content of the thesis has been partly published in: H H Liu, G K Chuah, S Jaenicke*, N-alkylation...
- 2
- 324
- 1
Supported group II transition metal catalysts in liquid phase reactions using borrowing hydrogen methodology 1
... metals can adsorb the reactant easily so that they can participate in a surface reaction A good catalyst should not absorb the reactants so strongly that they are irreversibly bound to the metal ... the activation of amines should in principle react with any available nucleophile The characteristic nucleophilicity of the amine substrate makes the transamination pathway available within the ... chemicals and materials are produced using catalysis at one stage or another The catalyst can either be dissolved in the reaction medium (homogeneous catalysis), or it can be a separate, normally...
- 221
- 658
- 0
Sự khác biệt giữa LEFT JOIN , RIGHT JOIN , INNERJOIN
... in: SELECT Employees.Name FROM Employees, Orders WHERE Employees.Employee_ID = Orders.Employee_ID AND Orders.Product = ‘Printer’ kết trả về: Name Hansen, Ola Sử dụng JOIN Ta sử dụng từ khoá JOIN ... bảng thứ hai (Orders) Nếu có dòng bảng Employees không ứng với dòng bảng Orders dòng tính kết trả về: Name Hansen, Ola Svendson, Tove Svendson, Stephen Svendson, Stephen Pettersen, Kari Product ... với dòng bảng Employees dòng tính kết trả về: Name Hansen, Ola Svendson, Stephen Svendson, Stephen Ví dụ: Ai đặt hàng máy in: SELECT Employees.Name FROM Employees INNER JOIN Orders ON Employees.Employee_ID...
- 3
- 13,035
- 29
Báo cáo khoa học: An engineered right-handed coiled coil domain imparts extreme thermostability to the KcsA channel docx
... KcsA channel Table DNA sequence of the synthesized rhcc gene ACCGTTATCATCGACGACCGTTACGAATCTCTGAAAAACCTGATCACCCTGCGTGCGGACCGTCTGGAAATGATTATCAACGACAACGTTTCTACCATCCTGGCGTCAATT TGA GAATTCTCATTAAATTGACGCCAGGATGGT-3¢ ... for KcsA–RHCC at pH and 8, respectively The open and closed states are indicated at the bottom of the chart NPo values at pH and are indicated above the graphs They are indicative of the mean levels ... thermostability of wtKcsA, C-terminal deleted KcsA (cdKcsA), KcsA–GCN4, KcsA–RHCC and Fig Biophysical characterization of KcsA–RHCC (A) CD spectra of tetrameric wtKcsA and KcsA–RHCC in LDAO Estimated a- helical...
- 11
- 395
- 0
Báo cáo khoa học: "Left-to-Right Target Generation for Hierarchical Phrase-based Translation" doc
... present a target-normalized hierarchical phrasebased translation model The model is a class of a hierarchical phrase-based model, but constrained so that the English part of the right-hand side The ... are induced from a bilingual corpus with the help of word alignments To alleviate a data sparseness problem, glue rules are 77 8 added that prefer combining hierarchical phrases in a serial manner: ... improvement against a phrase-based modeling Chiang (2005) introduced a hierarchical phrasebased translation model that combined the strength of the phrase-based approach and a synchronous-CFG formalism...
- 8
- 232
- 0
Báo cáo khoa học: "DETERMINISTIC LEFT TO RIGHT PARSING OF TREE ADJOINING LANGUAGES*" ppt
... captures the generalization of the nature of the derived trees of a CFG to the nature of derived trees of a TAG From Thatcher (1 971 ), we can observe that the path set of a CFG (i.e the set of ... The parsing program is the same for all LR parsers, only the parsing tables change from one grammar to another The parsing program reads characters from the input one character at a time The program ... LR(0): there is a conflict of action, the grammar cannot be parsed deterministitally without lookahead An example of a finite state automaton used for the construction of the LR(0) table for a TAG...
- 8
- 218
- 0
From business strategy to IT action right decisions for a better bottom line
... 1 977 He has worked with a large number of clients in the USA, Canada and Europe on critical IT measurement and management issues Mr Walton applies a combination of active research and practical ... for each NIE practice area and we use “maturity” as the measure of whether the company can produce the outcomes based on a combination of culture barriers and company capability to act on the ... 2 67 271 271 272 273 273 274 xix Contents The “So What?” for Line of Business Management The “So What?” for IT Management The “So What?” for the Business Continuing Development 274 275 276 276 APPENDICES...
- 354
- 577
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25