7 19 the laplace transform as a special case of the fourier transform
advanced calculus fifth edition - wilfred kaplan
... elementary calculus to handle the new applications of mathematics World War I1 had indeed created many new demands for mathematical skills in a variety of fields Mark was persuasive and I prepared a ... an algebraic equation of degree n for A , called the characteristic equation of the matrix A The eigenvalues of A are simply the real roots of the characteristic equation (The complex roots of ... it may happen that, for some scalar A , Av = hv (1 .78 ) If this occurs, we say that h is an eigenvalue of A and that v is an eigenvector of A, associated with the eigenvalue A The concept of eigenvalue...
- 754
- 903
- 0
Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx
... Moreover, there is also a variant of the BCP for self-maps of a non-Archimedean metric space proved by Prieß-Crampe [10] (also see Petalas and Vidalis [9]) It turns out that, in general, the contraction ... obtain only some particular cases of the contraction principle via a discrete argument Finally, we discuss a variant of ET given by Rus [11] (cf Remarks 2.1 and 4.3) Proof of Eilenberg’s theorem ... Actually, a minor modification of the above proof shows that the assumptions of Theorem 1.1 could be weakened: the relations Rn need not be transitive if we assume the uniqueness of a point x...
- 6
- 268
- 0
Báo cáo y học: "Menstruating from the umbilicus as a rare case of primary umbilical endometriosis: a case report" pot
... extravasation of the mucinous Umbilical endometriosis: endometriotic glands with metaplasia of the mucinous type and extravasation of the mucinous secretion into the adjacent stroma Majority of these ... presence of endometriotic glands with mucinous type metaplasia and extravasation of the mucinous secretion into the adjacent stroma (Figure 1) No epithelial atypia was seen and the excision appeared ... Endometriomas appear homogeneously hyperintense on T1-weighted sequences [10] MRI also has an advantage over laparoscopy for evaluating pelvic and extraperitoneal diseases, as well as lesions concealed...
- 3
- 383
- 0
Báo cáo y học: " Allergic hemiglossitis as a unique case of food allergy: a case report" ppt
... seen on the top of the left-hand side of the tongue (please see Figure 2) No other disability was reported and the sense of taste had also returned to normal The author(s) declare that they have ... left-hand side of the tongue was normal apart from mild restriction caused by the swelling No other pathology on the oral mucosa or in the throat was observed There was no skin rash or any other systemic ... interests Authors' contributions OA examined the patient, provided accurate management and arranged the initial case presentation report CD provided the references and amended the presentation Consent...
- 3
- 283
- 0
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"
... per annum decreased from 2 .77 to 2.68, and remained significant There was an increased risk of disability pension for people who were smokers at baseline, whereas there was no effect of BMI (table ... was stronger among men (OR=3.13) than among women (OR=2 .19) (Table 2) Additional analysis treating days of sickness absence during 199 0 as a continuous variable showed a clear trend of increase ... have analysed the determinants measured using the baseline DWECS questionnaire and disability pension data derived from DREAM among the 4 177 persons categorized as 18-45 year old employees at...
- 6
- 578
- 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... anesthesia workload and that a typical epidural takes about half the time of a typical cesarean Accordingly, the OAAI for each hospital was calculated as ((0 .75 * number of epidurals per year) + (1.5 ... (1) The ratio of the epidural and cesarean components of the OAAI (OAAI EPI and OAAI CD) was also calculated as follows: OAAICD/EPI = ( no of cesareans per yr *1.5 ) / ( no of epidurals per ... patient-controlled analgesia pumps The OAAI ignores clinical activities other than epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal...
- 14
- 610
- 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS The oligonucleotide ... differentiation Nucleic Acids Res 29, 3439–34 47 22 Yasuhara N, Shibazaki N, Tanaka S, Nagai M, Kamikawa Y, Oe S, Asally M, Kamachi Y, Kondoh H & Yoneda Y (20 07) Triggering neural differentiation of...
- 12
- 454
- 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... measured as described [ 17] DNase I protection assay Rat liver and HeLa nuclear extracts were prepared as described previously [18 ,19] The DNase I protection assay was performed as described [ 17] ... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... (5¢-TGACCTTGTCTCGTTGCCTCACCC-3¢) and ) 378 (5¢-GCTACAGGGATGCCAAAAGAACCC-3¢) for the Site-3, and primer set )346 (5¢-GCGTCTCACCCTAGT CCTGGTCCTGC-3¢) and )214 (5¢-GGAAGGGGCGGG TCCAGAGAACA-3¢) for the Site-2 element PCR was performed...
- 8
- 426
- 0
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx
... 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; PDZ3, forward: 5¢CCGAATTCCTTGGAGA TGATGAAATTACAAGGG-3¢, and reverse: 5¢GGATCCA TTCTTCAGGTCGATATTGTGCAAC-3¢ PCR products ... with the manufacturer’s instructions The sens mutagenic primers were: GRRF-PDZ1: 5¢GAAAGGGGAAATTCAGGGCGTCGT TTCAGCATTGCAGGAGG-3¢; GRRF-PDZ2: 5¢-ATTA AAGGTCCTAAAGGTCGTCGGTTTAGCATTGCTGGA GG-3¢; RAAV-MEK2: ... least one MAPK implicated in ERK activation to facilitate a functional interaction and regulate the localization and the duration of the signal For example, the MEK partner directs the ERK cascade...
- 11
- 419
- 0
Báo cáo lâm nghiệp: "Frost damage on the terminal shoot as a risk factor of fork incidence on common beech (Fagus sylvatica L.)" docx
... together, confirmed that “damage” was an explanatory factor which was much significant than the other variables and factors available Thus overall, the damage factor had both a statistical and a causal ... itself in a way, as its characteristics are always difficult to define accurately at the tree scale This type of experiment also has the advantage that the relative risks can be calculated easily It ... – – Undamaged 38 62 100 Total 1 07 102 209 Table II Main features of the logistic fit (Tab IIa), parameters estimates (Tab IIb), and comparison of the effect of damage (Tab IIc) The fit was performed...
- 8
- 348
- 0
báo cáo khoa học: "A rare case of xanthogranuloma of the stomach masquerading as an advanced stage tumor" ppt
... Retroperitoneal xanthogranuloma Am J Cancer 193 5, 23: 477 -489 Zafisaona G: Inflammatory fibrous histiocytoma of the stomach Apropos of a case of xanthogranuloma? Arch Anat Cytol Pathol 19 87, 35:149-153 Zhang ... xanthogranuloma as was found in the current case In our case, the gastric xanthogranuloma was preoperatively misdiagnosed as an advanced gastric cancer This occurred for the following reasons: ... Aikawa M, Ishii T, Nonaka K, Nakao M, Ishikawa K, Arai S, Kita H, Miyazawa M, Koyama I, Motosugi U, Ban S: A case of gastric xanthogranuloma associated with early gastric cancer Nippon Shokakibyo...
- 3
- 239
- 0
Báo cáo y học: "Dermoid cyst of the urinary bladder as a differential diagnosis of bladder calculus: a case report" pps
... Misra S, Agarwal PK, Tandon RK, Wakhlu AK, Misra NC: Bladder teratoma: a case report and review of literature Indian J Cancer 19 97, 34:20-21 Agrawal S, Khurana N, Mandhani A, Agrawal V, Jain ... Medical Case Reports 20 07, 1:32 http://www.jmedicalcasereports.com/content/1/1/32 Cauffield EW: Dermoid cysts of the bladder J Urol 195 6, 75 :801-804 Lazebnik J, Kamhi D: A case of vesical teratoma associated ... Journal of Medical Case Reports 20 07, 1:32 Figure ing from 1the anterior wall of the bladder Intra operative photograph showing the "bladder mass" arisIntra operative photograph showing the "bladder...
- 3
- 231
- 0
Báo cáo y học: " Involvement of the genicular branches in cystic adventitial disease of the popliteal artery as a possible marker of unfavourable early clinical outcome: a case report" pps
... graft Acta Chir Scand 195 4, 108:2 17 Flanigan DP, Burnham SJ, Goodreaau JJ, Bergan JJ: Summary of cases of adventitial cystic disease of the popliteal artery Ann Surg 1 979 , 189:165- 175 Cassar K, ... transluminal angioplasty Vasc Endovascular Surg 2009, 43(4):399-402 12 Khoury M: Failed angioplasty of a popliteal artery stenosis secondary to cystic adventitial disease: a case report Vasc Endovascular ... of the genicular branches in cystic adventitial disease of the popliteal artery as a possible marker of unfavourable early clinical outcome: a case report Journal of Medical Case Reports 2010 4:91...
- 4
- 333
- 0
Báo cáo y học: " Pelvic digit as a rare cause of chronic hip pain and functional impairment: a case report and review of the literature" pps
... literature For example, Lame [5] and Granieri and Bacarini [7] described a total of six cases, all consisting of a bony structure of at least two bony elements and at least one (pseudo-) articulation ... of a case Radiology 1 974 , 110:355-3 57 Lame EL: Case report 32 Skeletal Radiol 19 97, 2: 47- 48 Greenspan A, Norman A: The "pelvic digit": an unusual developmental anomaly Skeletal Radiol 198 2, 9:118-122 ... al [8] reported a case series where one patient had one phalanx and one pseudoarticulation, and two other cases with three bony segments and two pseudoarticulations A similar configuration was...
- 3
- 289
- 0
Báo cáo y học: "Pancreatic and psoas abscesses as a late complication of intravesical administration of bacillus Calmette-Guerin for bladder cancer: a case report and review of the literature" ppt
... cystoprostatectomy years earlier and had also had an endovascular stent-graft repair of an infrarenal abdominal aortic aneurysm The patient complained of abdominal pain in his right flank A physical ... that has been used to treat urothelial carcinoma since 1 976 and has been reported to eradicate disease in more than 70 % of patients with in situ and stage I disease [1] Although intravesical therapy ... examination revealed general poor health but pulmonary and cardiac examinations were unremarkable and the patient was afebrile Laboratory investigations were normal with the exception of anemia,...
- 4
- 273
- 0
Báo cáo y học: " Double rupture of interventricular septum and free wall of the left ventricle, as a mechanical complication of acute myocardial infarction: a case report" pot
... whereas the anterior wall appeared hypokinetic and the apex akinetic A coronary arteriography performed on the same day showed a total occlusion of the LAD branch in its proximal part along with an ... the literature in the late 1 970 s and early 198 0s established that there was no Page of (page number not for citation purposes) Journal of Medical Case Reports 2008, 2:85 place for procrastination, ... the anteroseptal AMI was complicated by VSD near the LV apex The episode of hypotension at the fifth post-infarct day was probably the manifestation of the second cardiac rupture (FWR), which was...
- 5
- 280
- 0
Báo cáo y học: " Coliform pyosalpinx as a rare complication of appendicectomy: a case report and review of the literature on best practice" pdf
... has given approval of the manuscript Consent The role of transvaginal drains and the effect of intra-fallopian antibiotic instillation on fertility still remains unclear One possible way to assess ... multiple necrotic areas oozing pus The fimbrial end was oedematous with a radius of cm The left fallopian tube was slightly enlarged and was found postrolateral to the uterus, adherent to the sigmoid ... irrigated generously with a 0.9% saline and Betadine mixture Microbiological analysis of the pus revealed Escherichia coli and anaerobes but not Chlamydia or Candida spp A postoperative Gastrografin...
- 3
- 346
- 0
Báo cáo y học: "Characterization of the HIV-1 RNA associated proteome identifies Matrin 3 as a nuclear cofactor of Rev function" ppsx
... RIPA buffer (50 mM Tris-Cl; pH 7. 5, 1% NP-40, 0.05% SDS, 150 mM CGAGATCCGTTCACTAATCGAATG B GGATTAACTGCGAATCGTTCTAGC C CGAGATCCGTTCACTAATCGAATG BA1 (b-actin) CATGTGCAAGGCCGGCTTCG BA4 (b-actin) GAAGGTGTGGTGCCAGATTT ... siGENOME SmartPool (UAGAUGAACUGAGUCGUUA, GACCAGGCCAGUAACAUUU, ACCCA GUGCUUGAUUAUGA, CCAGUGAGAGUUCAUUU AU), siGENOME Non-Targeting siRNA Pool #1 Either HeLa cells or 293T cells were transfected ... data AM conceived and coordinated the study, analyzed the data and wrote the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have...
- 15
- 470
- 0
Báo cáo y học: " siRNA screen of the human signaling proteome identifies the PtdIns(3,4,5)P3-mTOR signaling pathway as a primary regulator of transferrin uptak" docx
... (CDD) databases (Figure 2a; Additional data file 2) Components of canonical signaling pathways were included (for example, Ca2+, cAMP, and ERK), as well as less characterized and putative signaling ... d-siRNAs that resulted in an absolute value of the CAsH score ≥0.95 (see Additional data file for the list of primary hits and Figure S4 in Additional data file for the distribution of the CAsH ... image-based quantification of iron-loaded transferrin uptake in HeLa cells Automated image-based quantification of iron-loaded transferrin uptake in HeLa cells (a) Schematic representation of the...
- 11
- 286
- 0
Dirty industry migration and the environment china as a major case for study
... Cooperation APL Administrative Procedure Law of PRC (198 9) ASEAN Association of Southeast Asian Nations ASRCC Annual Statistics Reports of Chinese Customs ATCA Alien Torts Claim Act BIT Bilateral ... many academic staff of the Faculty of Law, National University of Singapore, notably Prof Tan Khee Jin, Alan, Professor Teo Keang Sood, Prof Thio Liann, Associate Prof Lim Chin Leng, Associate ... responsibility The removal of trade barriers such as tariffs, regulations, certain standards, legislation and regulatory measures, as well as removal of restrictions on capital flows and investments play a...
- 412
- 903
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng 9 tr 25