3 everyone is a customer

everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 3 docx

... relationships As we are fond of saying business is a dance with the customer and the customer always leads WHAT HAVE WE LEARNED? ❚ Our premise is that to achieve and maintain success in today’s customercentric ... anywhere—in a division of General Electric or in an individual free agent But what is a free agent? Since his article “Free Agent Nation” first appeared in Fast Company in January 1998, Daniel Pink has ... satisfy his or her needs on a personalized basis ❚ The Collaborative Community affords each business member and each customer transparent access to the specific information each requires In addition,...

24
363
0

Everyone is a customer pot

Danh mục: Tài chính doanh nghiệp

... collaborative business is not easily quantified and controlled This lack of analytical mechanisms puts collaborative relationships at risk ❚ The lack of analytical mechanisms puts collaborative ... countries such as Pakistan that previously supported the Taliban Fearing instability, Pakistan offered information about, and access to, the Taliban and Afghanistan to the United States In return, ... achieve shared goals and the benefit from doing so THE NEED TO COLLABORATE It is the new business mantra—collaborate, collaborate, collaborate But what is collaboration and why is everyone talking...

236
343
0

Everyone Is a Customer - A Proven Method for Measuring the Value of Every Relationship in the Era of Collaborative Business pot

Danh mục: Tài chính doanh nghiệp

... collaborative business is not easily quantified and controlled This lack of analytical mechanisms puts collaborative relationships at risk ❚ The lack of analytical mechanisms puts collaborative ... countries such as Pakistan that previously supported the Taliban Fearing instability, Pakistan offered information about, and access to, the Taliban and Afghanistan to the United States In return, ... achieve shared goals and the benefit from doing so THE NEED TO COLLABORATE It is the new business mantra—collaborate, collaborate, collaborate But what is collaboration and why is everyone talking...

236
507
0

Everyone Is a Customer - A Proven Method for Measuring the Value of Every Relationship in the Era of Collaborative Business pdf

Danh mục: Tài chính doanh nghiệp

... collaborative business is not easily quantified and controlled This lack of analytical mechanisms puts collaborative relationships at risk ❚ The lack of analytical mechanisms puts collaborative ... countries such as Pakistan that previously supported the Taliban Fearing instability, Pakistan offered information about, and access to, the Taliban and Afghanistan to the United States In return, ... achieve shared goals and the benefit from doing so THE NEED TO COLLABORATE It is the new business mantra—collaborate, collaborate, collaborate But what is collaboration and why is everyone talking...

236
617
0

everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 2 ppsx

Danh mục: Quản trị kinh doanh

... collaborative business is not easily quantified and controlled This lack of analytical mechanisms puts collaborative relationships at risk ❚ The lack of analytical mechanisms puts collaborative ... countries such as Pakistan that previously supported the Taliban Fearing instability, Pakistan offered information about, and access to, the Taliban and Afghanistan to the United States In return, ... achieve shared goals and the benefit from doing so THE NEED TO COLLABORATE It is the new business mantra—collaborate, collaborate, collaborate But what is collaboration and why is everyone talking...

24
323
0

everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 4 ppt

Danh mục: Quản trị kinh doanh

... that collaboration is required, top management made collaborative business a strategic mandate Yet shortly after the mandate was announced, the president of one division approached the ❘ It’s All ... real incentive for forming a collaborative relationship is a value proposition that brings increased strategic value to each party And strategic value is created whenever an exchange helps each ... generation What you try to make use of with this currency are actual products and services that can be bartered directly or made available in exchange for evaluating and testing information about...

24
301
0

everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 5 pdf

Danh mục: Quản trị kinh doanh

... Clearly, all of us have many necessary transactional relationships, even if they are not core It is also important to appreciate that a relationship remaining in the transactional quadrant over ... contrast, transactional and collaborative relationships are viable win-win states Having said that, you must keep in mind that over time your goals will change, and what is of value today may change ... that are made available to his tenants and that Max hopes will ultimately have an impact on his customer retention And if all goes well, Max will start earning fees from Dave We hope this simple...

24
245
0

everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 6 potx

Danh mục: Quản trị kinh doanh

... sinks Scenario I: Transactional Relationship A relationship that is, and will continue to be, transactional Transactional relationships are a viable state and for many relationships are exactly suited ... commitment and thereby move the relationship into the transactional quadrant Scenario C: Potential Collaborative Opportunity A transactional relationship you believe can and should iterate into a mutually ... core value to both parties Again, collaborative relationships are built over time and are based on trust and mutual benefit Scenario B: Critical Collaborative Opportunity A relationship that, although...

24
243
0

everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 7 ppt

Danh mục: Quản trị kinh doanh

... meet that goal based on your original assumptions and plans Accordingly, you can reevaluate and develop new assumptions and plans based on that knowledge While the Relationship Values and Deltas ... Trust? is a question anyone thinking about collaboration has to answer Previously we said that in diplomacy each party needs the faith required to negotiate the issues at hand As each party lives ... is established and more complex agreements, requiring greater sharing of information, can be negotiated It’s the same in business Listen to how Dr Hal Varian, dean of Information Management and...

24
290
0

everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 8 ppt

Danh mục: Quản trị kinh doanh

... on a real-time basis so that you can make the necessary changes on a real-time basis Critical metrics data must also be available in real time and accessible from anywhere So too must technical ... particularly in the area of data analysis For example, she says she wants to partner with a company that has “an analytical methodology (relationship currency of intellectual property) and dataintensive ... automated data exchange between and among individuals and/or organizations Common transactions like bids, purchase orders, receipts, invoices, and payments are automatically transmitted and updated...

24
377
0

everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 9 doc

Danh mục: Quản trị kinh doanh

... Your Goals 177 Evaluate Performance serve a customer A manager doesn’t have to wait to see the day’s sales to take action As soon as he observes it is taking longer to serve a customer than desired, ... representatives of two other trade publications that heard us speak have also asked us to write for their online and offline magazines and are listed as Trade Publications (3) and (4) Each of these ... John at the agency, which was higher than the 4.4 value we had calculated for Delphi in January This means that despite the fact that it was already mid-August, we believed that the value of the...

24
210
0

everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 10 ppt

Danh mục: Quản trị kinh doanh

... Fair market value, 41 Federal Express, 63 64 Firewalls, 159 Free agent, 31 34 , 36 entrepreneurial mindset and, 33 34 , 36 Free Agent Nation (Pink), 31 Future Relationship Value, 171 Georgia-Pacific ... significant business decisions by now valuing, measuring, and managing strategic relationships at their fundamental human level Second, you can use a broader approach that includes cash and currencies ... INDEX Ace, 42 Alliances, 13 Analysis and refinement, 178 Analytical mechanisms, 13 14,...

20
202
0

Tài liệu Cạnh tranh thông qua 3 nguyên tắc giá trị căn bản – Sự mong đợi từ phía khách hàng. HP Financial Services. Competing Through 3 Value Disciplines – A Customer’s Perspective docx

Danh mục: Tin học văn phòng

... Ka Wah Bank Bank Mandiri Bank Ce ntral As ia S ing apo re S to c k Exc hang e Citibank in As ia Pac ific ING in As ia Pac ific China Life – DCC SOUTH EAST ASIA HuaXia Co mme rc ial Bank China ... Kong 1979 Asia emerging countries • • • • Pakistan Bangladesh Sri Lanka Cambodia Brunei Nepal Maldives Laos Singapore, 1970 APJ HQ Australia 1967 Copyright ©20 03 HP corporate presentation All rights ... 40,000 enterprise & commercial channel partners J apan 19 63 China 1985 Taiwan 1970 Southeast Asia • • • • • Philippines Thailand Vietnam Malaysia Indonesia 1995 1989 1996 1972 1996 India 1989 Hong...

15
553
0

kỹ thuật đo lường 3 - What is a sensor ?

Danh mục: Điện - Điện tử - Viễn thông

... What is a sensor ? • A sensor is a device which receives and responds to a signal or stimulus Here, the term "stimulus" means a property or a quantity that needs to be converted into electrical ... sensor can be defined as a device which receives a signal and converts it into electrical form which can be further used for electronic devices A sensor differs from a transducer in the way that a ... way that a transducer converts one form of energy into other form whereas a sensor converts the received signal into electrical form only Application Application Application Application Các chuyển...

34
336
0

Báo cáo khoa học: The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity pot

Danh mục: Báo cáo khoa học

... hypoxia for 36 h, with sense primer 5¢-GAGAATTC TCG CAG AGC GGG GAG GAG AAC -3 and antisense primer 5¢-AT GGATCC TCA AAA GGT ACT AGT GGA AGT TG -3 The PCR product was ligated to pGEM-T (Promega) ... striata, Tris ⁄ HCl-injected striata and CL uninjected striata from Tris ⁄ HCl-injected rats A 60 kDa band was present in KA-injected striata (Fig 1E); this band was much weaker in CL striata, and ... death distinct from necrosis and apoptosis as deﬁned by classical morphological and molecular criteria [17] It was also shown that excitotoxicity activates cell death programs that result in atypical...

9
388
0

Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modiﬁed conotoxin, reveals that the glycan structure is a-D-Gal-(1ﬁ3)-a-D-GalNAc pot

Danh mục: Báo cáo khoa học

... and Chemical shift (p.p.m.) Proton (1H) Chemical shift (p.p.m.) Disaccharide: Gal-GalNAc Proton (1H) GalNAc:H1 GalNAc:H3 GalNAc:H3 Gal:H1 Gal:H1 Gal:H2 GalNAc:CH3 GalNAc:CH3 GalNAc:CH3 4.79 3. 77 ... Chemical shift (p.p.m.) GalNAc:H1 GalNAc:CH3 GalNAc:H3 GalNAc:H1 Gal:H2 Gal:H2 4.79 1.79 3. 77 4.79 3. 53 3. 53 10ThrcCH3 12AlaaH 10ThrcCH3 10ThrbH 11AlaßCH3 12AlaaH 0.98 4.07 0.98 4.04 1.09 4.07 anomeric ... GalNAc:CH3 4.79 3. 77 3. 77 4.82 4.82 3. 53 1.79 1.79 1.79 GalNAc:H2 GalNAc:H2 Gal:H1 Gal:H2 Gal:H3 Gal:H4 Gal:H2 Gal:H3 Gal:H4 3. 95 3. 95 4.82 3. 53 3. 43 3.72 3. 53 3. 43 3.72 Proton (1H) Chemical shift (p.p.m.)...

11
563
0

Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf

Danh mục: Báo cáo khoa học

... replace Ser274 in ik3-1 cDNA with Thr or Ala, mutagenic primers, 50 -TCTCCGGAGATGTCGAACACT CTCAGGTACTCCCAGACCA -30 or 50 -TCTCCGGAGAT GTCGAACACTCTCAGGTGCTCCCAGACCA -30 (corresponding to amino-acid ... residue is also phosphorylated by both cdk3/cyclin A and cdk3/E in vivo (Fig 5) Analysis of ik3-1 amino-acid sequence indicates that ik3-1 has a putative ZRXL (Z and X are typically basic) motif that ... phosphorylation of FLAG – p70ik3-1 below the normal state (compare lanes and of the upper panel in Fig 3A, and lanes and in Fig 3B), we assume that other types of kinases phosphorylate FLAG–p70ik3-1 at...

7
308
0

Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

Danh mục: Hóa học - Dầu khí

... coli alcohol dehydrogenase Vaidyanathan et al AMB Express 2011, 1 :37 http://www.amb-express.com/content/1/1 /37 Page of Table Bacterial strains and plasmid vectors used in this work Strain or plasmid ... 1:2.5 has been used in this study for elevated 1, 3- PD synthesis (Tobajas et al 2009) Fermentation was carried out at 37 °C and 250 rpm, in an anaerobic condition The pH was maintained at 5.5 ... (2008) Table Primers and peptide sequences used in this work Primer name Primer sequencea yqhDF (Forward) 5’-CATG CCATGG ACAACAACTTTAATCTGCACACC -3 yqhDR (Reverse) 5’-CCG CTCGAG TTAGCGGGCGGCTTC -3 ...

8
399
0

Chapter 3 Filling Vacant PositionsWhat is a Position pdf

Danh mục: Kỹ năng bán hàng

... specifically identify a position for recruitment, examination and certification or layoff when job analysis has shown that the special characters and qualifications of the position so necessitate NAME ... or related to tasks on their PD This is also acceptable as long as other contractual and legal requirements are met For example, there are limitations on the assignment of "bargaining unit" work ... Description? A position description cannot and does not list every task an employee must perform as part of their job Tasks which are understood as necessary to accomplish the goals listed on a PD are...

4
362
0