3 sex is a learned behavior

Báo cáo khoa học: The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity pot

Báo cáo khoa học: The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity pot

Ngày tải lên : 22/03/2014, 17:20
... hypoxia for 36 h, with sense primer 5¢-GAGAATTC TCG CAG AGC GGG GAG GAG AAC -3 and antisense primer 5¢-AT GGATCC TCA AAA GGT ACT AGT GGA AGT TG -3 The PCR product was ligated to pGEM-T (Promega) ... striata, Tris ⁄ HCl-injected striata and CL uninjected striata from Tris ⁄ HCl-injected rats A 60 kDa band was present in KA-injected striata (Fig 1E); this band was much weaker in CL striata, and ... death distinct from necrosis and apoptosis as defined by classical morphological and molecular criteria [17] It was also shown that excitotoxicity activates cell death programs that result in atypical...
  • 9
  • 388
  • 0
Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot

Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot

Ngày tải lên : 23/03/2014, 13:20
... and Chemical shift (p.p.m.) Proton (1H) Chemical shift (p.p.m.) Disaccharide: Gal-GalNAc Proton (1H) GalNAc:H1 GalNAc:H3 GalNAc:H3 Gal:H1 Gal:H1 Gal:H2 GalNAc:CH3 GalNAc:CH3 GalNAc:CH3 4.79 3. 77 ... Chemical shift (p.p.m.) GalNAc:H1 GalNAc:CH3 GalNAc:H3 GalNAc:H1 Gal:H2 Gal:H2 4.79 1.79 3. 77 4.79 3. 53 3. 53 10ThrcCH3 12AlaaH 10ThrcCH3 10ThrbH 11AlaßCH3 12AlaaH 0.98 4.07 0.98 4.04 1.09 4.07 anomeric ... GalNAc:CH3 4.79 3. 77 3. 77 4.82 4.82 3. 53 1.79 1.79 1.79 GalNAc:H2 GalNAc:H2 Gal:H1 Gal:H2 Gal:H3 Gal:H4 Gal:H2 Gal:H3 Gal:H4 3. 95 3. 95 4.82 3. 53 3. 43 3.72 3. 53 3. 43 3.72 Proton (1H) Chemical shift (p.p.m.)...
  • 11
  • 563
  • 0
Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf

Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf

Ngày tải lên : 24/03/2014, 04:21
... replace Ser274 in ik3-1 cDNA with Thr or Ala, mutagenic primers, 50 -TCTCCGGAGATGTCGAACACT CTCAGGTACTCCCAGACCA -30 or 50 -TCTCCGGAGAT GTCGAACACTCTCAGGTGCTCCCAGACCA -30 (corresponding to amino-acid ... residue is also phosphorylated by both cdk3/cyclin A and cdk3/E in vivo (Fig 5) Analysis of ik3-1 amino-acid sequence indicates that ik3-1 has a putative ZRXL (Z and X are typically basic) motif that ... phosphorylation of FLAG – p70ik3-1 below the normal state (compare lanes and of the upper panel in Fig 3A, and lanes and in Fig 3B), we assume that other types of kinases phosphorylate FLAG–p70ik3-1 at...
  • 7
  • 308
  • 0
Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

Ngày tải lên : 20/06/2014, 23:20
... coli alcohol dehydrogenase Vaidyanathan et al AMB Express 2011, 1 :37 http://www.amb-express.com/content/1/1 /37 Page of Table Bacterial strains and plasmid vectors used in this work Strain or plasmid ... 1:2.5 has been used in this study for elevated 1, 3- PD synthesis (Tobajas et al 2009) Fermentation was carried out at 37 °C and 250 rpm, in an anaerobic condition The pH was maintained at 5.5 ... (2008) Table Primers and peptide sequences used in this work Primer name Primer sequencea yqhDF (Forward) 5’-CATG CCATGG ACAACAACTTTAATCTGCACACC -3 yqhDR (Reverse) 5’-CCG CTCGAG TTAGCGGGCGGCTTC -3 ...
  • 8
  • 399
  • 0
Chapter 3 Filling Vacant PositionsWhat is a Position pdf

Chapter 3 Filling Vacant PositionsWhat is a Position pdf

Ngày tải lên : 13/07/2014, 23:21
... specifically identify a position for recruitment, examination and certification or layoff when job analysis has shown that the special characters and qualifications of the position so necessitate NAME ... or related to tasks on their PD This is also acceptable as long as other contractual and legal requirements are met For example, there are limitations on the assignment of "bargaining unit" work ... Description? A position description cannot and does not list every task an employee must perform as part of their job Tasks which are understood as necessary to accomplish the goals listed on a PD are...
  • 4
  • 362
  • 0
everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 3 docx

everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 3 docx

Ngày tải lên : 10/08/2014, 11:20
... anywhere—in a division of General Electric or in an individual free agent But what is a free agent? Since his article “Free Agent Nation” first appeared in Fast Company in January 1998, Daniel Pink has ... change The goal, of course, is to change in a manner that continually leads to an increased ability of the community to profitably satisfy customers THE CHOREOGRAPHER Let’s take a closer look at ... Collaborative Community are similar to those required of a choreographer of dance Encyclopaedia Britannica describes choreography as “the gathering and organization of movement into order and pattern...
  • 24
  • 363
  • 0
Báo cáo y học: "Matrin 3 is a co-factor for HIV-1 Rev in regulating post-transcriptional viral gene expressio" pptx

Báo cáo y học: "Matrin 3 is a co-factor for HIV-1 Rev in regulating post-transcriptional viral gene expressio" pptx

Ngày tải lên : 13/08/2014, 01:21
... the major nuclear matrix proteins Proc Natl Acad Sci USA 1991, 88:1 031 2-1 031 6 51 Hisada-Ishii S, Ebihara M, Kobayashi N, Kitagawa Y: Bipartite nuclear localization signal of matrin is essential ... M, Asano S, Nakamura T, Adachi M, Yoshida M, Yanagida M, Nishida E: CRM1 is responsible for intracellular transport mediated by the nuclear export signal Nature 1997, 39 0 :30 8 -31 1 38 Askjaer P, ... 5′GTCTCTCTGGTTAGACCAG -3 , Primer C 5′-CTAGTCAAAATTTTTGGCGTACTC -3 and primer A and sj4. 7A 5′- TTGGGAGGTGGGTTGCTTTGATAGAG -3 for spliced Kb transcript For GAPDH forward 5′ CTCTGCTCCTCCTGTTCGAC 3 and GAPDH...
  • 10
  • 313
  • 0
Tumor cell response to drug induced apoptosis is a function of intra cellular redox status 3

Tumor cell response to drug induced apoptosis is a function of intra cellular redox status 3

Ngày tải lên : 16/09/2015, 17:11
... to thank all the staff at Dept of Physiology especially Dr.Prakash Hande and Dr Lina Lim for their guidance I am grateful to Ms Asha Rekha Das, Vasantha and Kamsitah for their administrative ... One caspase can activate another caspase leading to the formation of a caspase cascade that amplifies the death signal In a typical cell undergoing apoptosis two distinct mechanisms have been ... central mechanism that can be specifically targeted for the treatment of cancer Caspases are a family of proteins that play an important role as effectors of apoptosis The caspases are a group...
  • 193
  • 366
  • 0
C elegans PRDM1 blimp1 homolog BLMP 1 is a positive regulator of bed 3 transcription

C elegans PRDM1 blimp1 homolog BLMP 1 is a positive regulator of bed 3 transcription

Ngày tải lên : 01/10/2015, 17:28
... CACAAAGCTTTTATGGATAATGCGGC AATC CACAGAATTCAGCTGTACACGGCCT GTTGC CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAATCATTTAATGGAGTT CCAAA CACAAAGCTTAAAAGATTCCCAGAT TTCCAT CACAGCTAGCTCATTTAATGGAGTTC CAAA ... TI01 93 2406 (in pET-2 1a) TI0248 CACATCTAGAAATGGGTCAAGGAAG TGGGGA CACAAAGCTTTTATGGATAATGCGGC AATC CACAGAATTCATGGGTCAAGGAAGT GGGGA CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAAAGCTGTACACGGCC TGTTGC CACAAAGCTTTTATGGATAATGCGGC ... GCGCGTCGACAG ACAAAATGGTGG GCCGATGAAGGG TI02 53: CGCGTCTAGACG CGCAATCGTCTAC AAAGC TI0295: AGACAAAATGGTGGGCC GATGAAGGGCCATCAGC ACCGGTT TI02 53: CGCGTCTAGACGCGCAA TCGTCTACAAAGC TI 030 0: GCGCGTCGACAG ACAAAATGGTGG...
  • 85
  • 291
  • 0
C  elegans PRDM1 blimp1 homolog BLMP 1 is a positive regulator of bed 3 transcription

C elegans PRDM1 blimp1 homolog BLMP 1 is a positive regulator of bed 3 transcription

Ngày tải lên : 02/10/2015, 12:56
... CACAAAGCTTTTATGGATAATGCGGC AATC CACAGAATTCAGCTGTACACGGCCT GTTGC CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAATCATTTAATGGAGTT CCAAA CACAAAGCTTAAAAGATTCCCAGAT TTCCAT CACAGCTAGCTCATTTAATGGAGTTC CAAA ... TI01 93 2406 (in pET-2 1a) TI0248 CACATCTAGAAATGGGTCAAGGAAG TGGGGA CACAAAGCTTTTATGGATAATGCGGC AATC CACAGAATTCATGGGTCAAGGAAGT GGGGA CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAAAGCTGTACACGGCC TGTTGC CACAAAGCTTTTATGGATAATGCGGC ... GCGCGTCGACAG ACAAAATGGTGG GCCGATGAAGGG TI02 53: CGCGTCTAGACG CGCAATCGTCTAC AAAGC TI0295: AGACAAAATGGTGGGCC GATGAAGGGCCATCAGC ACCGGTT TI02 53: CGCGTCTAGACGCGCAA TCGTCTACAAAGC TI 030 0: GCGCGTCGACAG ACAAAATGGTGG...
  • 85
  • 157
  • 0
PERFECT PRESENTATIONS Presenting with impact is a skill that can be learned by anyone

PERFECT PRESENTATIONS Presenting with impact is a skill that can be learned by anyone

Ngày tải lên : 27/06/2016, 10:30
... Public Speaking • Many dread it • Basic skills can be learned to get message across • With application and good training anyone can be a fluent and confident speaker • A great asset you will use ... not the laptop • Is about the message you want to convey Presentation • Like a glass containing good whisky • The glass contain the whisky so that people can appreciate and savour it • Allow people ... interest and enthusiasm, • in a way that keeps the attention of your audience Presentation • Always about selling something • An idea • A different way of thinking Presentation tools Presentation...
  • 23
  • 393
  • 0
 What is a Company Visual Identity?

What is a Company Visual Identity?

Ngày tải lên : 23/10/2012, 13:53
... Extended palette An extended palette is available for broader (screen) applications Compared with the basic palette, this colour palette comprises a number of heavier shades Each typeface is available ... thousands are separated by a comma; main and decimal sums by a decimal point For example: EUR 1,250.00 In Dutch, thousands are separated by a dot, main and decimals sums by a comma If there are ... with a similar function already exist, or can this new form be combined with an existing form? - Does the form have a name, and is this name as short as possible? - Is all the information requested...
  • 14
  • 879
  • 0
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"

Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"

Ngày tải lên : 25/10/2012, 10:31
... and extravascular lung water index (EVLWI), based on a transpulmonary thermodilution technique [30 ,31 ] All relevant laboratory and medical data, including APACHE II [32 ] and SOFA scores [33 ], were ... following variables were found to be statistically significant at a 10% level in the univariate analysis and subjected to multivariate Cox regression analysis: lactate, APACHE II score, SOFA score and ... data reveal an important limitation for Ang-2 as a quantitative marker for vascular permeability: high Ang-2 might be a surrogate parameter for increased capillary permeability per se, but is...
  • 9
  • 634
  • 0
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

Ngày tải lên : 25/10/2012, 10:35
... form 36 and health-related quality of life after intensive care in Morocco Acta Anaesthesiol Scand 2007, 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation of a behavioral ... presented as the mean ± standard deviation for variables with a normal distribution, and as the median and interquartile range for variables with skewed distributions Parametric or nonparametric ... Ferrari A, Rizzotti P, Luzzani A: Procalcitonin in the diagnosis of inflammation in intensive care units Clin Biochem 2006, 39 :1 138 -11 43 Khoudri I, Zeggwagh AA, Abidi K, Madani N, Abouqal R: Measurement...
  • 10
  • 597
  • 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

Ngày tải lên : 03/11/2012, 10:52
... hypothesis was rejected at the 0.05 level in all analyses Statistical analysis Results Statistical analyses were performed using SigmaStat (version 3. 0, SPSS Inc., Chicago, IL) Independently measured ... Cruz Biotech, CA) The assay was developed using a stabilized HRP substrate All samples were analyzed in the linear range of the ELISA using over-expressed human Vgf as a standard Assessment of ... the ALS phenotype 98 10 11 12 13 14 Acknowledgements Supported by ALS grant from the Department of Veterans Affairs, NCCAM 5R21 AT002602-02 and NCCAM 1R21 AT0 036 32-0 1A1 to GMP and NARSAD and...
  • 8
  • 499
  • 0
Life Is a Dream

Life Is a Dream

Ngày tải lên : 06/11/2012, 14:12
... philosophical significance LIFE IS A DREAM DRAMATIS PERSONAE Basilio King of Poland Segismund his Son Astolfo his Nephew Estrella his Niece Clotaldo a General in Basilio's Service Rosaura a Muscovite Lady ... ROS And now a lamp, a lamp! And now the hand That carries it FIFE Oh, Lord! that dreadful chain! ROS And now the bearer of the lamp; indeed As strange as any in Arabian tale, So giant-like, and ... national type of drama which Lope had established was maintained in its essential characteristics by Calderon, and he produced abundant specimens of all its varieties Of regular plays he has left a...
  • 11
  • 367
  • 0
bai 5: tiet 3: tây nam á và trung á

bai 5: tiet 3: tây nam á và trung á

Ngày tải lên : 31/05/2013, 00:21
... Thiên Ch a giáo, Tin Lành, Ki-tô giáo,… Các quốc gia: Azerbaijan, Bahrain, Sip, Gruzia, Iran, Iraq, Israel, Jordan, Kuwait, Liban, Oman, Palestin (dải Gaza Bờ Tây), Qata, rập Saudi, Syria, Các ... Tây Nam Á a) Vị trí đ a lí: -Tây Nam Á (hay Tây Á) bao gồm vùng núi Caucasus, bán đảo Arabi sơn nguyên Tiểu Á, Armenia, Iran - Lãnh thổ Tây Nam Á nằm hai lục đ a rộng lớn lục đ a Á-Âu lục đ a Phi, ... Nam Á a) Vị trí đ a lí: Tây Nam Á a) Vị trí đ a lí: Tây Nam Á giáp: vịnh Pec-xich, biển Ả-rập, Biển Đỏ, Đ a Trung Hải, Biển Đen, Biển Caxpi, châu Âu, châu Phi, khu vực Trung Á , Nam Á Tây Nam...
  • 17
  • 2.4K
  • 28

Xem thêm