0

2500 m 200 000 000 12 5 ms to get the total delay we need to add propagation delay in the equipment 10 ms this results in t 22 5 ms

bài giải bài tập truyền số liệu

bài giải bài tập truyền số liệu

Điện - Điện tử - Viễn thông

... calculate the propagation time as t = ( 250 0 m) / (200, 000. 000) = 12. 5 μs To get the total delay, we need to add propagation delay in the equipment (10 μs) This results in T = 22 .5 μs CHAPTER 14 ... 0101 100 0 1101 0100 0011 1100 1101 0 010 011 1101 0 11 1101 10 15 The first byte in binary is 0 100 00 11 The least significant bit is This means that the pattern defines a multicast address A multicast address ... data of 151 0 bytes, therefore, must be split between two frames The standard dictates that the first frame must carry the maximum possible number of bytes ( 150 0); the second frame then needs to...
  • 108
  • 2,368
  • 1
Báo cáo khoa hoc:

Báo cáo khoa hoc:" Perfluorodecaline residue in the anterior chamber of a patient with an intact crystalline lens: a case report" ppt

Báo cáo khoa học

... operation (a and b) Giant retinal tear with shallow detached retina involving the macula in the right eye (c) Reattachment of retina after vitrectomy sis, but could not obtain these results as the ... to remove the perfluorodecaline without any delay In the case presented here, we would like to demonstrate that even though the patient has an intact crystalline lens, PFCLs may be postoperatively ... encountered in the anterior chamber due to zonular defects during vitrectomy surgery or in eyes with trauma Concent Written consent of the patient was obtained for publication of this case report...
  • 3
  • 310
  • 0
báo cáo hóa học:

báo cáo hóa học:" Research Article Resource Allocation for the Multiband Relay Channel: A Building Block for Hybrid Wireless Networks" ppt

Hóa học - Dầu khí

... a total power constraint between the source and the relay and assume that each has its own battery We assume that the system has total bandwidth W We define the received SNRs at the relay and the ... allocation parameters that maximize capacity lower bound in terms of the transmitted power and the total bandwidth for (k, m) MBRC, which leads to optimally allocating the source power among m source ... is the transmitted signal vector from the source and XSc is the transmitted signal vector from the source intended for direct transmission Similarly, X {m+ 1, ,k} is the transmitted signal from the...
  • 13
  • 305
  • 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Báo cáo khoa học

... The ratio of metals incorporated into SOD mutants examined showed a reduction in selectivity in the order: no glutamine > one glutamine[wt] > two glutamines > one glutamine (the double mutants) ... with the MnSOD mutants is due to the lack of activity in these mutants with iron at the active site, despite there being some 20% iron in the Mn[G77Q/Q146A] mutant (Tables and 2) The differential ... ECM -5 d (5 -AGCTATACCCTGCCATCCCTG) and ECM-3¢ d (5 -TTATTTTTTCGCCGCAAAACGTG) and E coli genomic DNA as template PCR was carried out using Amplitaq enzyme according to the manufacturer’s instructions...
  • 12
  • 740
  • 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx

Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx

Báo cáo khoa học

... significantly to the disappearance of nitrotyrosinated tubulin, the tyrosination/detyrosination at the C-terminus of a-tubulin is the main operating mechanism Furthermore, when cells maximally nitrotyrosinated ... injection of nitrotyrosine into mouse brain led to striatal neurodegeneration, although the nature of the amino acid bound at the C-terminus of a-tubulin in the striatum was not investigated Further ... estimated by immunoblot) was not altered by substitution of C-terminal tyrosine by nitrotyrosine Furthermore, proportions of nitrotyrosinated tubulin and total tubulin were the same in assembled...
  • 9
  • 518
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article On the Throughput Capacity of Large Wireless Ad Hoc Networks Confined to a Region of Fixed Area" pptx

Hóa học - Dầu khí

... (94) into ( 95) and combining all constants into one, we obtain the statement of the theorem TIGHTENING THE BOUNDS Although the main focus of this paper is to demonstrate the possible switching ... data to send to d(i) Each node is constrained to a maximum transmit power of P The available bandwidth is equal to W The time is assumed to be divided into slots of unit length Let M j (t) be the ... node throughput increases as n(α−1)/2 In this regime, the total noise power dominates the interference power and the effect of the increasing SINR is able to overcome the effect of increasing number...
  • 11
  • 464
  • 0
EFFECTIVE THERMAL INSULATION – THE OPERATIVE FACTOR OF A PASSIVE BUILDING MODEL ppt

EFFECTIVE THERMAL INSULATION – THE OPERATIVE FACTOR OF A PASSIVE BUILDING MODEL ppt

Kĩ thuật Viễn thông

... the heat move in a dynamic system or diminish the temperature change, with time, in a static system The thermal belongings of insulating materials and other standard fishing vessel building materials ... garden also Often the representatives of these two entwined disciplines not meet, or come together to late, when they can but tolerate each other It would be better if they met to discuss and ... system and the quality of the heating equipment are major elements in keeping the building comfortable Air movement and drafts, the thermal properties of the surfaces we touch, and relative humidity...
  • 112
  • 449
  • 0
Báo cáo toán học:

Báo cáo toán học: "The Quantum Double of a Dual Andruskiewitsch-Schneider Algebra Is a Tame Algebra" pdf

Báo cáo khoa học

... algebra by direct computations Then using this, we get its Ext-quiver with relations which will help us to get the desired conclusion Main Results In this section, we will study the Drinfeld Double ... 201 We now repeat the process on the second term of the last identity, and continue until there is an arrow in front of all the terms; so there exist scalars βi , βi and βi such that the following ... isomorphism Γu Ku,j → Γu Ku,j X h of Γu -modules Proof The proof is very similar to the proof of Lemma 2 .22 in [7] In order to prove this lemma, we must show that right multiplication by X h embeds...
  • 19
  • 386
  • 0
Báo cáo toán học:

Báo cáo toán học: "The characteristic polynomial of a graph is reconstructible from the characteristic polynomials of its vertex-deleted subgraphs and their complements" doc

Báo cáo khoa học

... from the two decks belong to a vertex-deleted subgraph and its complement This is crucial to the proof of Theorem 3.1 Finally, the referee noted that the result from the title can be reformulated ... (G)}, we used Lemma 2.3 to prove that the characteristic polynomial is also reconstructible But there is an alternative argument to this Let PG (x) be the derivative of the characteristic polynomial ... determined by the isomorphism classes of its vertex-deleted subgraphs is the most general case of problems of this type There are counter-examples to the question of whether a graph invariant...
  • 9
  • 363
  • 0
Báo cáo toán học:

Báo cáo toán học: "The crossing number of a projective graph is quadratic in the face–width" doc

Báo cáo khoa học

... of Theorem 1.2 The idea of the previous statement readily translates into an approximation algorithm, namely: • We test whether the input graph G embeds in Σg using the O(n)-time algorithm by Mohar ... selecting the remaining Mg − cycles from C to form C ⊇ {e, f } of size Mg + Hence the counting argument yields that the k k−2 total number of crossings in D is at least Mg +1 / Mg −1 = k(k − 1)/(Mg ... approximation algorithm that computes the crossing number crg of a projective graph with maximum degree ∆ within a constant factor This last statement is proved in Section Finding a large diamond...
  • 8
  • 336
  • 0
Báo cáo toán học:

Báo cáo toán học: "The maximum size of a partial spread in H(4n + 1, q 2) is q 2n+1 + 1" docx

Báo cáo khoa học

... in H (5, q 2) can never exceed q + Their proof relies on counting methods, and they also obtain additional information on the structure of partial spreads which meet this bound q + In this note, ... Proof The inner distribution vector a simply has a on the position corresponding with the identity relation, and |S| − on the position corresponding with the relation defining the graph Γ We now ... K Metsch The maximum size of a partial spread in H (5, q 2) is q + J Combin Theory Ser A, 114(4):761–768, 2007 [6] P Delsarte The association schemes of coding theory In Combinatorics (Proc NATO...
  • 6
  • 327
  • 0
Báo cáo toán học:

Báo cáo toán học: "The toric ideal of a matroid of rank 3 is generated by quadrics" pps

Báo cáo khoa học

... subsections Note that the matroid may have more bases than the bases that belong to the initial red or blue partitions In other words, the bases appearing in the figure are not all of the bases of the ... theorem for matroids on sets of size less than n Let {B1 , , Bk } be the initial blue partition We separate the inductive step into two cases according to the relative position between the initial ... a mathematical induction on the size of the ground set We describe the base case of the induction in Section and describe the step in Section Base case of induction In this section, we show the...
  • 12
  • 270
  • 0
Báo cáo y học:

Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx

Báo cáo khoa học

... AGCACCAACTCGCCCTCATC, Cdk9 (reverse) TTCAGCCTGTCCTTCACCTTCC Competing interests The author(s) declare that they have no competing interests Authors' contributions WY performed the experiments in MM6 ... oligonucleotides were inserted into a hU61 plasmid vector immediately after the human U6 promoter The U6 promoter driven-shRNA expressing cassettes were then subcloned into the FG12 lentiviral vector The FG12 ... Following 24 hours of PMA treatment, MM6 cells aggregated and became loosely attached to the bottom of the culture dishes (data not shown), mimicking the differentiation of monocytes into macrophages...
  • 16
  • 178
  • 0
KẾT CẤU MỚI  THE ENVIRONMENTAL CONSEQUENCES OF A BUILDING WITH A WIDE SPAN

KẾT CẤU MỚI THE ENVIRONMENTAL CONSEQUENCES OF A BUILDING WITH A WIDE SPAN

Kiến trúc - Xây dựng

... and transmitted to the brain The signals are processed by the brain and the nerves in the retina to generate sensations which we interpret as "seeing" The retina can integrate the photons it receives ... out when they reach the tropopause The point about this introduction is that the air in very large spaces is mixed by turbulent convection currents The other point to notice is that at the tropopause ... nodes were at the same temperature with the same heat gain The heat gain would be equated to the temperature rise and the relaxation process might be stopped before getting a proper answer We changed...
  • 12
  • 207
  • 0
The Marketing Strategy of a multinational join stock company.doc

The Marketing Strategy of a multinational join stock company.doc

Quản trị kinh doanh

... concept for international marketing Le Kim Hong Tu _ 5D The Marketing Strategy of a multinational join stock company Chapter The marketing strategy of a multinational join stock company 2.1 An introduction ... Company trading results Total sales Net profit 20 05 5. 527 59 5 2006 7.0 35 650 2007 10. 783 927 2008 21 .57 9 1. 250 Table 2.1: A multinational join stock company’s trading results in recent Unit: million ... _ 5D The Marketing Strategy of a multinational join stock company Conclusion The first part of the thesis concepts related to marketing and the theory that will be later based on to research The...
  • 25
  • 623
  • 8
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Kỹ thuật lập trình

... This is the default None, meaning that changes to the CustomerID DataColumn of customersDT are not cascaded to ordersDT Let's examine the three most important cases that vary the checking of the ... default Checked, meaning that changes to the CustomerID primary key value in the Customers table are cascaded to the Orders table In addition, the settings of interest for the UpdateRule property ... also made in the child DataTable This is the default None Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in...
  • 6
  • 428
  • 0
Tài liệu Exporting the Results of a Query to an Array pdf

Tài liệu Exporting the Results of a Query to an Array pdf

Kỹ thuật lập trình

... duplicates the functionality of the ADO GetRows( ) method The prototype for the ADO.NET method is: Object[][] tableArray = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); ... to export to the array startRow The row number of the first row to export fields A string array containing the names of the columns to export If this parameter is null, all columns are exported ... columns to the // number of columns in the table; otherwise, set the number of // columns to the number of items in the specified columns array int nCols = (colName == null) ? dt.Columns.Count...
  • 5
  • 309
  • 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Báo cáo khoa học

... G G G T T T T T T T T T T M M M M M M M M M M T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T H H H H H H H H H H S S S S S S S S S S Y Y Y Y Y Y Y Y Y Y T T T T T T T T T T G G G ... the interaction of the R197A mutant with CP12, it seems that the mutated Arg residue is not directly involved in the interaction with the small protein It is likely that the introduction of the ... of the global structure of the mutants To test whether the interactions of these mutants with the other partners of the GAPDHCP12PRK complex were impaired, we have tried to reconstitute in vitro...
  • 8
  • 494
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx

Báo cáo khoa học

... related to the missing words Consider the hypotheses of latent vectors in table for bank#n#1 Assume there are dimensions in our latent model: financial, sport, instituv tion We use Ro to denote the ... to obtain an intuitive feel for what is captured by wmfvec For example, the target word mouse in the context: in experiments with mice that a gene called p53 could transform normal cells into ... similarities, (3) (Sinha and Mihalcea, 2007 ) [jcn+elesk], where they evaluate six sense similarities, select the best of them and combine them into one system Specifically, in their implementation...
  • 5
  • 585
  • 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khoa học

... different pHoptima The present results show that protonation of the catalytic glutamate is promoted by substrate-binding In other words, it is the substrate itself that ensures that this glutamate ... values in the apo-enzyme), are similar in the wildtype enzyme and in most mutants It thus seems that the assumptions underlying this interpretation of the two different pH-activity plots [43] not ... which in fact is one of the least active mutants described in this report The acidic shift in the pH-optimum of the D215N mutant shows that Asp2 15 has a second major role in catalysis, namely to increase...
  • 10
  • 651
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25