Human embryonic stem cells as a cellular model for osteogenesis in implant testing and drug discovery
Báo cáo y học: "Low temperature tolerance of human embryonic stem cells"
... JM Embryonic stem cell lines derived from human blastocysts Science 1998;282(5391):1145-7 Reubinoff BE, Pera MF, Fong CY, Trounson A, Bongso A Embryonic stem cell lines from human blastocysts: ... Germany) with an HBO-103 mercury lamp and filter sets for FITC, Cy3.5, Texas Red, Cy5, Aqua, and DAPI Images were captured, processed, and analyzed using ISIS mBAND/mFISH imaging software (MetaSystems ... mammalian embryos and oocytes rapidly lose their viability even upon relatively short durations of exposure to low temperature [15, 16] Although later stage pre-implantation embryos of mice (8-cell and...
- 6
- 477
- 0
báo cáo hóa học:" Transplantation of vascular cells derived from human embryonic stem cells contributes to vascular regeneration after stroke in mice" docx
... transplanted vascular cells derived from human ES cells and the vascular density in the infarct area after the transplantation In the saline- and hMNCs-injected groups, the vascular density of host ... characterization of transplanted cells derived from human ES cells We induced differentiation of human ES cells in an in vitro two-dimensional culture on OP9 stromal cell line and examined the expression of ... The findings reported here demonstrate that the transplantation of vascular cells, ECs and MCs derived from human ES cells, to the ischemic brain significantly promoted vascular regeneration in...
- 14
- 450
- 0
báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc
... family, the miR-200 family have been reported in human [16,17] and mouse embryonic stem cells [18-20] The unique patterns of miRNA expression in embryonic stem cells suggest they are involved in maintaining ... instance, miR-373 induces the expression of E-cadherin and CSDC2 by targeting their promoter region and initiate their expression[ 73] Another mechanism is that the engagement of miRNA and their targets ... names of human embryonic stem (hES) cells lines P denoted the number of passages of the cell lines H9-EB denoted embryoid body (EB) prepared from cell line H9 and the day indicates the time in culture...
- 17
- 593
- 0
báo cáo hóa học:" Human embryonic stem cells hemangioblast express HLA-antigens" pot
... functional hemangioblasts from human embryonic stem cells Nat Methods 2007, 4(6):501-9 Zambidis ET, Peault B, Park TS, Bunz F, Civin CI: Hematopoietic differentiation of human embryonic stem cells ... the expression of MHC proteins in human embryonic stem cells Proc Natl Acad Sci USA 2002, 99(15):9864-9 Li L, Baroja ML, Majumdar A, Chadwick K, Rouleau A, Gallacher L, et al.: Human embryonic stem ... Platt JL: Immunosuppression by embryonic stem cells Stem Cells 2008, 26(1):89-98 Fabricius D, Bonde S, Zavazava N: Induction of stable mixed chimerism by embryonic stem cells requires functional Fas/...
- 10
- 409
- 0
Báo cáo khoa học: "Human embryonic stem cells and therapeutic cloning" pdf
... adult stem cells is their inability to effectively grow in Human embryonic stem cells and therapeutic cloning culture Therefore, obtaining clinically significant amounts of adult stem cells may ... and characterization of human embryonic stem cells Stem Cells Dev 2004, 13, 325-336 18 Drukker M, Benvenisty N The immunogenicity of human embryonic stem- derived cells Trends Biotechnol 2004, ... transplantation, embryonic stem cells, and the potential for cell therapy N Eng J Med 2003, 349, 275-286 27 Hogan B, Beddington R, Costantini F, Lacy E Isolation, culture and manipulation of embryonic stem cells...
- 10
- 403
- 0
Báo cáo y học: "Local adherent technique for transplanting mesenchymal stem cells as a potential treatment of cartilage defect" pdf
... were harvested during total Table Histological scoring system for cartilage repair Category Points Cell morphology Hyaline cartilage Mostly hyaline cartilage Mostly fibrocartilage Mostly non -cartilage ... necessary, thereby increasing the safety and economic feasibility Our study will advance and extend the clinical application of MSC-based cell therapy for cartilage injury Materials and methods Rabbits ... cartilage In vivo analysis in rabbits repair by synovial mesenchymal stem cell transplantation in rabbits (a) Cell transplantation on a cartilage defect in a rabbit by the local adherent technique The...
- 10
- 470
- 0
báo cáo khoa học: "Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease" potx
... Rada-Iglesias A, Wysocka J: Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease Genome Medicine 2011, 3:36 ... Feinberg AP: Differential methylation of tissue- and cancer-specific CpG island shores distinguishes human induced pluripotent stem cells, embryonic stem cells and fibroblasts Nat Genet 2009, 41:1350-1353 ... Young R: Stem cells, the molecular circuitry of pluripotency and nuclear reprogramming Cell 2008, 132:567-582 Gonzalez F, Boue S, Belmonte JC: Methods for making induced pluripotent stem cells: ...
- 13
- 338
- 0
Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy
... status of gene therapy for glioma and breast cancer 22 1.4 Stem cells 1.4.1 Adult stem cells 1.4.1.1 Neural stem cells 1.4.2 Induced pluripotent stem cells 1.5 Stem cell as a vehicle for cancer ... primers as follows: was performed using the forward and reverse CodA, GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA -3’ (reverse), size:1.2kb; Fcy 5’-AGGAATTCATGGTGACAGGGGGAATG ... potential benefit As these cancers have a high risk of relapse, irrespective of grade and stage, they account for a large proportion of metastatic breast cancers (Irvin WJ and Carey 2008) 4T1 mammary...
- 134
- 439
- 0
Differentiation and derivation of lineage committed chondroprogenitors and chondrogenic cells from human embryonic stem cells for cartilage tissue engineering and regeneration
... plating of hESC-derived chondrogenic cells Fig 17 Chondrogenic differentiation capability of hESC-derived chondrogenic cells Fig 18 Analysis of pluripotency and lineage- restriction of hESC-derived chondrogenic ... explored for their potential as viable cell sources for cartilage tissue engineering (Chung et al., 2008) Human embryonic stem cells (hESCs) are stem cell lines of embryonic origin, isolated from ... biomaterial and biophysical stimulations have been employed to harness the chondrogenic potential of hESCs for cartilage regeneration and tissue engineering 2.2.1 Expansion of hESCs Human embryonic stem...
- 190
- 471
- 0
Establishment of autologous culture systems for human embryonic stem cells
... sources, named embryonic stem cells Literature review (ESCs), embryonic germ cells, fetal stem cells, umbilical cord stem cells, adult stem cells and induced pluripotent stem (iPS) cells (Ariff ... cell source for future clinical applications Literature review Table Characterization of stem cells by derivation source Category Embryonic stem cells Embryonic germ cells Fetal stem cells Umbilical ... Xiao R, and Cao T Establishment of Autologous Feeders for Human Embryonic Stem Cells Propagation 2nd Meeting of IADR Pan Asian Pacific Federation (PAPF) and the 1st Meeting of IADR Asia/Pacific...
- 214
- 481
- 0
Role of sonic hedgehog signalling in human embryonic stem cells and its neural derivatives
... culture feeding 3.2.3 Human embryonic stem cells and induced pluripotent stem cells Human embryonic stem cell line HES-3 (46, XX) was from ES Cell International (Singapore, http://www.escellinternational.com) ... forebrain, midbrain, hindbrain and the spinal cord This figure was reproduced from Epstein et al., 1999 2.4 SHH and neural development During the initial phase of neural induction, the ectoderm is induced ... Immunoflourescent staining of neural stem cell marker Nestin in SHH-CM and Control-CM treated EB Middle panel shows corresponding DAPI nuclear staining in blue and right panel shows corresponding...
- 178
- 546
- 0
Transcriptome study of human embryonic stem cells and knockdown study of a pluripotency marker, LIN28
... CATGTTCGGTTGGTCAAAGA CCCAAGAGATCCCCCACAT GTTGTTACCTCAAACCTCCTTTCC GCACCACGAACGCCTTTG GCGGTGTGCGGATGGTA CCCTAGAGATAAGGCGCTTCAG AAGATGGTGGATGCTTCCAAAA ACCACTCGGAGGACCTGTTTT ACAGCAAATGACAGCTGCAAA ... GACCTCCACAGTTGTAGCAA 3’ TRCN 0000102579 LIN28sh2F 5’ CGCGTCATCTGTAAGTGGTTCAACGTTTCAAGAGAACGTTGAACCAC TTACAGATGTTTTTCATATGAT 3’ LIN28sh2R 5’ CGATCATATGAAAAACATCTGTAAGTGGTTCAACGTTCTCTTGAAAC GTTGAACCACTTACAGATGA ... TGGGCATCAGGCCAAGTC TGCAGGTCCCTTGGACATG TGGCGCCGGTTACAGAAC AAGCTGTATATTTACTCATTGAAA CAC GCCATCATCATTACCCATTGC GCCCAATACGACCAAATCC ACCCGTGGTCACCATGGTA Chapter Results 3.1 SAGE data analysis to search...
- 109
- 371
- 0
Human embryonic stem cells as a cellular model for osteogenesis in implant testing and drug discovery
... using human embryonic stem cells and derivatives as cellular model in implant testing for two main reasons One, human embryonic stem cells are the very original cells that our human body is developed ... OCT4 F: CGRGAAGCTGGAGGAGAAGGAGAAGCTG 55 oC R: AAGGGCCGCAGCTTACACATGTTC NANOG F: GGCAAACAACCCACTTCTGC 55 oC R: TGTTCCAGGCCTGATTGTTC β-ACTIN F: ACAGAGCCTCGCCTTTGCC 58 oC R: ACATGCCGGAGCCGTTGTC 2.1.5 ... creating iPSCs from human adult somatic cells by two independent teams led by Shinya Yamanaka and James Thomoson Yamanaka‘s group used the same retroviral system as they did for mouse fibroblasts...
- 117
- 385
- 0
Từ khóa: adipose stem cells as a valuable target for researchmorphology of human embryonic stem cells and induced pluripotent stem cells cultured in feeder layer free conditionsisolation characterization and differentiation of human embryonic stem cellshuman embryonic stem cells international policy and regulation megan allyse and stephen mingerhuman embryonic stem cells derivation and culture emma l stephenson peter r braude and chris masonsuccessful scale up and quality assessments of human embryonic stem cells for cell therapy challenges and overviewhuman embryonic stem cells from laboratory and clinical perspectivesderivation methods for human embryonic stem cells past present and future pdfisolation of human embryonic stem cells from various stages of the human embryo pdfquantitative 2d imaging of human embryonic stem cells ý pdfhuman embryonic stem cells in drug discovery pdf5 human embryonic stem cellsestablishment of new lines of human embryonic stem cells evolution of the methodologyhuman embryonic stem cells derived in xeno free conditionsprocedures for derivation and characterisation of human embryonic stem cells from odense denmarkBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP