English idioms containing the word “heart” and its synonyms in Vietnamese A contrastive analysis from cultural perspectives

... contrasting Methods of the study The main method applied in this thesis is contrastive analysis of idioms containing the word “heart” in English and its synonyms in Vietnamese from cultural perspectives ... characteristics 1.1.3 Idiomatic expressions containing the word “heart” in English and its synonyms in Vietnamese 1.1.3.1 Literal and figurative meanings of “heart” and its synonyms in Vietnamese ... expressions containing the word “heart” and its synonyms in Vietnamese “Have a big heart, break your heart, follow heart” are examples of heart- based idioms in English In Vietnamese, there are more than...

NHỮNG THÀNH NGỮ TIẾNG ANH CÓ CHỨA TỪ “HEART” VÀ TỪ ĐỒNG NGHĨA VỚI “HEART” TRONG THÀNH NGỮ TIẾNG VIỆT: ĐỐI CHIẾU NHÌN TỪ GÓC ĐỘ VĂN HÓA = english idioms containing the word heart and its synonyms in vietnamese idioms a contrastive analysis from cultural

... VIETNAMESE IDIOMS: A CONTRASTIVE ANALYSIS FROM CULTURAL PERSPECTIVES (NHỮNG THÀNH NGỮ TIẾNG ANH CÓ CH A TỪ HEART VÀ TỪ ĐỒNG NGH A VỚI HEART TRONG THÀNH NGỮ TIẾNG VIỆT: ĐỐI CHIẾU NHÌN TỪ GÓC ... containing the word heart and its synonyms in Vietnamese In each language, idioms containing words of human body part possess a remarkable figure According to statistics in Longman Dictionary ... based idioms in English are ones containing the word heart “Have a big heart, break your heart, follow heart are examples of heart- based idioms in English In Vietnamese, there are more than...

51
1,069
3

English idioms containing the word Heart and its synonyms in Vietnamese idioms a contrastive analysis from cultural perspectives

... Idiomatic expressions containing the word heart in English and its synonyms in Vietnamese 13 1.1.3.1 Literal and figurative meanings of heart and its synonyms in Vietnamese 13 1.1.3.2 Idiomatic ... Implications for learning and translating idioms in general 35 Suggestions for further studies 37 REFERENCES 38 APPENDICES Appendix 1: English idioms containing heart I Appendix 2: Vietnamese idioms ... expressions containing the word heart and 14 its synonyms in Vietnamese 1.1.4 Some characteristics of Vietnamese and English culture 15 1.1.4.1 Hofstede’s value dimensions 15 1.1.4.2 Characteristics...

A study of the vietnamese translation of english non finite clauses and its application in vietnamese and english translation

... What are the implications on teaching, learning and – finite Clauses and Its Application in Vietnamese English translating non – finite clauses? Translation 1.5 ORGANIZATION OF THE STUDY 1.2 AIMS ... translated in Therefore, the results of the study of the ways of Vietnamese the form of a verb, a noun, an adverb and a finite clause They have translation of English non – finite clauses and its ... equivalents of non – finite Vietnamese Translation of English Non – finite Clauses and Its clauses is very abundant For example, in the translating process, Application in Vietnamese English Translation ,...

13
1,030
3

The verb to have in english and its equivalents in vietnamese

... can find the equivalents in using the verb "to have" both in English and in Vietnamese because the basic meaning of the verb to have in the two languages are quite the same However , the meaning ... ordinary verb and its equivalents in Vietnamese - Helping them know and apply the verb to have in some constructions and its equivalents in Vietnamese - By means of teaching suggestions of the verb ... encourages us to choose the topic: The verb "to have" in English and its equivalents in Vietnamese - Aims of the study - Helping Vietnamese learners understand the usages of the verb to have when...

Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc

... that the hypodermis of the body wall, which synthesizes components of the cuticle, may offer a useful target for studies into the mechanism of the development and molting process in the roundworms ... presence of increasing concentrations of inhibitors for 10 days, and the number of molting larvae was determined Molting was manifested by shedding of the L3 cuticle Results Identiﬁcation of cDNA ... involved in the molting process, we examined the effects of two PPase speciﬁc inhibitors, imidodiphosphate (IDP, 1-0631; Sigma) and NaF on development and molting of A suum lungstage L3 to fourth-stage...

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identiﬁed and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains and a single KH domain similar ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1 (ANKHD1) variants,...

A study on rhyming slang in English and its equivalents in Vietnamese.

... Some slang words and expressions can spread outside their original arena, and some may even lose their slang status and become accepted as a standard language; for example, in English : Adam and ... dialect and common in London at the time, containing aspects of Cockney rhyming slang, Romany,Back slang, Italian,theatre language ,criminal language….etc But today, it seems to be died out Example: ... words and expressions can spread outside their original arena, and some may even lose their slang status and become accepted as a standard language Often, the widespread adoption of a slang term...

báo cáo khoa học: "Analysis of the expression pattern of the BCL11B gene and its relatives in patients with T-cell acute lymphoblastic leukemia" doc

... clarify the role of BCL11B in T-cell malignancies, we further analyzed the expression levels of TNFSF10, BCL2L1, SPP1, and CREBBP genes and their correlations with BCL11B in patients with T-ALL and ... of the SPP1 gene in T-cell malignancies is unclear, because low expression of SPP1 was detected in T-ALL Conclusions The expression pattern of the BCL11B gene and four of its related genes (TNFSF10, ... electrophoresis analysis The size of the PCR products of the b2M gene used for the BCL11B reference is 332 bp (line 1, 2) and that used for the four genes of interest is 145 bp (line 4-11) Line 3: DNA ladder...

Báo cáo y học: "The organisation of the stress response, and its relevance to chiropractors: a commentary" pdf

... pathways, and then projects to central, basal and basal accessory nuclei of the amygdala [28], as well as to the hippocampus, orbitofrontal cortex, cingulate [29] and via the reticular activating ... periphery, though they are able to indirectly and bilaterally influence sympathetic and parasympathetic preganglionic neurons via the efferent paraventricular pathway [18] The hypothalamus is able to ... important information The amygdala has neuronal projections to the paraventricular nucleus of the hypothalamus, and this amygdalo-hypothalamic pathway is believed to influence the activity of the...

a study on connotative equivalence between gone with the wind and its translation in vietnamese by duong tuong = nghiên cứu tương đương biểu cảm giữa tác phẩm cuốn theo chiều gió

... THE WIND" AND ITS TRANSLATION IN VIETNAMESE BY DUONG TUONG NGHIÊN CỨU TƯƠNG ĐƯƠNG BIỂU CẢM GI A TÁC PHẨM "CUỐN THEO CHIỀU GIÓ" VÀ BẢN DỊCH TIẾNG VIỆT C A DƯƠNG TƯỜNG MA Combined Programme Thesis ... more than 20 years ago Among several versions of the translation, the one translated by Duong Tuong is most praised by readers With the aim of investigating one of Duong Tuong' s best translated ... translation at the same time, in a translation, the image of the original‟s author is parallel to the one of the translator Landers as a translation theorist and translator himself states the requirement...

77
1,158
3

idioms denoting intelligence and understanding in english and vietnamese a contrastive analysis and teaching implications = phân tích đối chiếu và gợi ý giảng dạy các thành ngữ chỉ sự thông minh và hiểu biết

... ENGLISH AND VIETNAMESE: A CONTRASTIVE ANALYSIS AND TEACHING IMPLICATIONS PHÂN TÍCH ĐỐI CHIẾU VÀ GỢI Ý GIẢNG DẠY CÁC THÀNH NGỮ CHỈ SỰ THÔNG MINH HIỂU BIẾT TRONG TIẾNG ANH VÀ TIẾNG VIỆT M .A Minor ... Summary In this chapter, the author has analyzed and contrasted idioms denoting intelligence and understanding in English and Vietnamese in syntactic and semantic features to find out similarities ... language was born Concluding remarks on objective 2: some teaching implications for idioms denoting intelligence and understanding From analysis and contrasting idioms denoting intelligence and...

linguitic means to express modality in offers in english and vietnamese - a contrastive analysis = phân tích đối chiếu các phương tiện ngôn ngữ thể hiện tình thái trong câu đề nghị tiếng anh và tiếng việt

... MODALITY IN OFFERS IN ENGLISH AND VIETNAMESE A CONTRASTIVE ANALYSIS (Phân tích đối chiếu phương tiện ngôn ngữ thể tình thái câu đề nghị tiếng Anh tiếng Việt) M .A Minor Thesis Field: English Linguistics ... Aims of the study The study aims at : -2 - - Exploring the modality markers in making offers in English and Vietnamese - Comparing and contrasting the range of modality markers in order to clarify ... information that can help teachers and learners of English gain an insight into modality in general and modality in the speech act of offering in specific, which contributes to the teaching and...

48
1,098
6

A study on connotative equivalence between Gone with the wind and its translation in Vietnamese by Duong Tuong

... of connotative equivalence achieved between the novel "Gone with the wind" and its translation by Duong Tuong? What strategies adopted by the translator to achieve such types of connotative equivalence? ... The novel was first translated into Vietnamese more than 20 years ago Among several versions of the translation, the one translated by Duong Tuong is most praised by readers With the aim of investigating ... All the above made the researcher decide to carry out the study on equivalence in literary translation Specifically, the study investigates connotation equivalence achieved in the translation...

Negative questions in English and Vietnamese - A contrastive analysis

... learner’s awareness in teaching and learning English and Vietnamese negative questions Scope of the study The study English negative questions in English and Vietnamese - a contrastive analysis ... between English and Vietnamese negative questions have been analysed and pointed out With an ambition to help teachers and learners have a clear understanding about the English and Vietnamese negative ... instructions and encouragement from him And lastly, the contrastive analysis is made intra- and interlingually: English negative questions with Vietnamese counterparts, contrastive analysis involves...

49
3,081
25

Xem thêm

Từ khóa: heart in english and its synonyms in vietnamese the o fid and its applications in petroleum product analysis the institutional army and its place in the u s army english inquiry letters requesting samples of information about products in shopping online an analysis from a systemic functional grammar apos s perspective idiomatic expressions containing the word eye in english and vietnamese comparative analysis between idiomatic expressions containing the word eye in english and vietnamese equivalents new textbook english 10 the standard textbook and its language focus section new textbook english 10 the standard textbook and its listening section water distribution and its balance in the body the circuitry of the human spinal cord its role in motor control and movement disorders disorders of the pituitary gland and its hypothalamic control diseases of the nervous system and its symptoms explain the structure of unix operating system and its components in brief unspecified disorder of the pituitary gland and its hypothalamic control importance of tourism industry and its role in the philippine economy Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam