Báo cáo khoa học: "Changing of Women’s Roles in Agricultural and Handicraft Production: A Case Study in Kim Thieu Village, Tu Son District, Bac Ninh Province" pdf

... number of activities together, but mainly based on farming and craft making. However, agricultural 50 Changing of Women’s Roles in Agricultural and Handicraft Production: The traditional ... 1. Craft making only (loaned farmland to other villagers) 30 2. Craft making and rice cultivation in allocated land only 40 3. Craft making and rice cultivation in both allocated and borrowed ... polishing and cleaning products before selling. 54 Journal of Science and Development April 2008: 49-59 HANOI UNIVERSITY OF AGRICULTURE Changing of Women’s Roles in Agricultural and Handicraft...

Báo cáo khoa học: " Expression of pituitary adenylate cyclase activating polypeptide and its type I receptor mRNAs in human placenta" doc

... the same areas. Although our data did not elucidate thephysiological role and action mechanism of PACAP in human placenta, the localization of PACAP and its PAC1receptor in the same areas strongly ... suggest that PACAP mayact as an autoregulator or pararegulator via its PAC1 receptor in stem villi and terminal villi during pregnancy. In conclusion, our findings suggest that PACAP may have animportant ... determine the existence of PACAP and PAC1 receptor mRNAs in human placenta. Our data showedthe expression of PACAP and PAC1 receptor mRNAs in stroma cells of stem villi and terminal villi. As...

Báo cáo khoa học: "Effect of intern’s consecutive work hours on safety, medical education and professionalism"

... the same number of interns, in the traditional armwould have meant that each intern admitted and cared formore patients. In other words, each intern would have had a heavier workload and, therefore, ... performance of upper-levelresidents and other medical staff across a variety of disciplines. We likewise agree that optimizing patient hand-offs, medical education, and trainees’ sense of professionalism ... First,although the study by Lockley and colleagues used a within-subjects analytical design [2], the study by Landrigan and colleagues did not [3]. A systemic-level approach rather than a within-subjects...

Tài liệu Báo cáo khoa học: Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activity ppt

... transferred to a new Petri dish and incu-bated overnight with medium containing gentamicin.Bacterial growth of each strain was assessed by viablecounts, both during initial infection and also ... GST-ExoS(DALDL424–428AAAAA) S419QGLLAAAAA428This study 7. GST-ExoS(D42 4A; D42 7A) S419QGLLAALAL428This study 8. GST-ExoS(S419I)I419QGLLDALDL428This study 9. GST-ExoS(Q42 0A) S419AGLLDALDL428This study 10. ... :428AA) (data not shown).The basic cluster of amino acids in the bindinggroove of 14-3-3, including amino acids Lys-49, Arg-56, Lys-120 and Arg-127, in an otherwise acidic mole-cule, are...

Tài liệu Báo cáo khoa học: Basis of recognition between the NarJ chaperone and the N-terminus of the NarG subunit from Escherichia coli nitrate reductase pdf

... only minor confor-mational changes upon binding the twin-arginine signalpeptide of NapA [18]. In this case, biogenesis of theNapA protein is assisted by NapF in charge of cofactorloading [19,20]. ... considerable research into chaperonefunction, only partial structural information has beengained on the nature and site of peptide interaction[9–12]. Biophysical studies have indicated that Tatsignal ... 2010)doi:10.1111/j.1742-4658.2010.07611.x A novel class of molecular chaperones co-ordinates the assembly and targeting of complex metalloproteins by binding to an amino-terminalpeptide of the cognate substrate. We have previously...

Tài liệu Báo cáo khoa học: Effect of siRNA terminal mismatches on TRBP and Dicer binding and silencing efﬁcacy pdf

... theirbinding to the RNA-induced silencing complex loading complex proteinsHIV transactivating response RNA-binding protein and Dicer in H1299cytoplasmic extracts. Binding of siRNA and the transactivating ... Dicer and Ago2 alone are capable of forming an active mini-mal RLC [13].Being double-stranded, either strand of the siRNAcan be used as the guide strand of an active RISC.KeywordsDicer; mismatches; ... mRNA cleavage or translational inhibition [1]. In the cytoplasm of human cells, the dsRNA bindingproteins HIV transactivating response RNA-bindingprotein (TRBP) and Dicer recognize and bind thesiRNA...

Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

... (5¢-CTTCCTCCGCTTCCATGA-3¢) and QaCgClp1 (5¢-CCATGAAGTCCGCGAATC-3¢); and QsCgClp2 (5¢-GCATAGCGATGTGGACGA-3¢) and QaCgClp2 (5¢-GAGGACCGAGACCGTGAA-3¢). Theabbreviations ‘Qs’ and ‘Qa’ refer, respectively, ... generated by 5¢- and 3¢-RACE using the Marathon cDNA ampliﬁcation kit(Clontech, Takara, Mountain View, CA, USA). Double-stranded cDNA from oyster mantle edges was ligated toadaptors, and 25 ... theiCycler apparatus (Bio-Rad, Hercules, CA, USA). TotalRNA was isolated from oocytes, embryos, larvae and adulttissues using Tri-Reagent (Sigma-Aldrich) according to themanufacturer’s instructions....

Tài liệu Báo cáo khoa học: Oligomerization of the Mg2+-transport proteins Alr1p and Alr2p in yeast plasma membrane pptx

... B2-linker-ATTGTAACGGCTATATCTACTGGALR-c36SU3¢ B2-linker-GGCAAGAAGCTCGAAATAACCALR-c63SU3¢ B2-linker-CCAATAGCTGGCCAAGAACCALR-c96SU3¢ B2-linker-ATTCATACCGAAAAGACCC ALR2-HIS-f ATTTTTATGAGAAAACGTGAAAAAACTTCGTAATGTCGTCCTTATCGTACGCTGCAGGTCGACALR2-HIS-r ... ATTTTTATGAGAAAACGTGAAAAAACTTCGTAATGTCGTCCTTATCGTACGCTGCAGGTCGACALR2-HIS-r AAAGATCTGCCGACCTACCATAGCGGTCATGTTAATTGTAACGGCATCGATGAATTCGAGCTCGALR2-up TTCGAAAAATGCAGCATTHIS3-r TCTACAAAAGCCCTCCTACCD ALR2mutR-EforCCAGGAGAGAATTCAAGTATTGCALR2mutR-ErevGCAATACTTGAATTCTCTCCTGGALR2-5¢SacII-f ... TTTCTGCAGGAGCTCGAAAAATGCAGCATTTGGALR2-PstI-r AAACTGCAGGATTGTAACGGCTATATCTACE Alr1-rtp CAGGGTATGGATGAAACGGTTGCAlr1-rtm TGATCCCGAAGTGGAAGTAGAGCAlr2-rtp TTAAGTTCTAATGCGAGGCCATCCAlr2-rtm TTCGTTCACTGTGCCTTTGATGGACT1_plus ACCAAGAGAGGTATCTTGACTTTACGACT1_minus...

Tài liệu Báo cáo khoa học: Association of mammalian sterile twenty kinases, Mst1 and Mst2, with hSalvador via C-terminal coiled-coil domains, leads to its stabilization and phosphorylation doc

... (Genesearch, Arundel, QLD,Australia).Plasmids and cDNAsThe mammalian expression plasmid, pcDNA3 (Invitrogen,Melbourne, VIC, Australia), containing N-terminally ﬂag-tagged human Salvador (hSav) cDNA ... A. Callus1,*, Anne M. Verhagen1 and David L. Vaux1,*1 The Walter and Eliza Hall Institute, Parkville, VC, AustraliaThe mammalian serine ⁄ threonine kinases, Mst1 and Mst2, were originally ... pro-apoptotic mammalian sterile20 kinases 1 and 2 (Mst1 and 2), and Salvador (Sav) has a human orthologue hSav (also called hWW45). Herewe show that Mst and hSav heterodimerize in an interaction...

Tài liệu Báo cáo khoa học: Modulation of oat arginine decarboxylase gene expression and genome organization in transgenic Trypanosoma cruzi epimastigotes docx

... results indicatethat agmatine cannot fulﬁll the physiological roles of polyamines, and at the same time strongly suggest thatT. cruzi does not contain agmatinase activity thatwould convert agmatine ... 633Modulation of oat arginine decarboxylase gene expression and genome organization in transgenic Trypanosoma cruziepimastigotesMarı´ a P. Serra, Carolina Carrillo, Ne´lida S. Gonza´lez and ... N+; Amersham).Total RNA from parasites, before and after transforma-tion, was obtained using TRIzol LS reagent (Invitrogen,Carlsbad, CA, USA) [29]. Samples containing 20 l goftotal RNA were...

Xem thêm