0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Ca2+-binding allergens from olive pollen exhibit biochemical and immunological activity when expressed in stable transgenic Arabidopsis pdf

Báo cáo khoa học: Ca2+-binding allergens from olive pollen exhibit biochemical and immunological activity when expressed in stable transgenic Arabidopsis pdf

Báo cáo khoa học: Ca2+-binding allergens from olive pollen exhibit biochemical and immunological activity when expressed in stable transgenic Arabidopsis pdf

... recombin-ant allergens may offer the possibility of having available edible vaccines in the near future. In this study, two EF-hand-type Ca2+-binding allergens from olive pollen, Ole e 3 and ... clinical and scientific purposes, aswell as for developing new ways of vaccination.ResultsObtaining Arabidopsis transgenic plantscontaining Ole e 3 and Ole e 8 cDNAsBinary pROK2-OLEE3 and ... pollen exhibit biochemical and immunological activity when expressed in stable transgenic Arabidopsis Amalia Ledesma1, Vero´nica Moral2, Mayte Villalba1, Julio Salinas2 and Rosalı´a...
  • 10
  • 365
  • 0
Báo cáo khoa học: Actin-binding domain of mouse plectin Crystal structure and binding to vimentin pot

Báo cáo khoa học: Actin-binding domain of mouse plectin Crystal structure and binding to vimentin pot

... hand, doesn’t seem to be requiredfor actin-binding as calponin interacts with actin via itsC-terminal domain [51]. Thus, with an IF protein-bindingsite residing in their N-terminal CH domains ... (1995)Utrophin actin binding domain: analysis of actin binding and cellular targeting. J. Cell Sci. 108, 63–71.10. Gimona, M. & Winder, S.J. (1998) Single calponin homologydomains are not actin-binding ... domain. This additional amino-terminalintermediate filament protein binding site of plectin mayhave a function in intermediate filament dynamics and assembly, rather than in linking and stabilizing...
  • 12
  • 477
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Portable Translator Capable of Recognizing Characters on Signboard and Menu Captured by Built-in Camera" docx

... useful information. These include destina-tions and notices in transportation facilities, namesof buildings and shops, explanations at sightseeingspots, and the names and prices of dishes in restau-rants. ... user specifies the beginning and ending of the character string to be recognized and translated. In Figure 3, circles on both ends of thestring denote the user specified points. All the lo-cations ... delineated by rect-angles and have x,y coordinates (as shown in Fig-ure 2), the module considers all candidates and ratesthe arrangement of rectangles according to the dif-ferences in size and...
  • 4
  • 493
  • 0
Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf

Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf

... domain fused to a DNA-binding domain (DBD) and a ligand-binding domain(LBD). The chimeric gene (transactivation domain–DBD–LBD) is expressed under the control of a con-stitutive promoter. In ... germinate and grow on the inductionmedia for 20 days in the case of Arabidopsis and for4 weeks in the case of tobacco, at 25 °C, under 16 h oflight and 8 h of dark.MicroscopyThe transgenic Arabidopsis ... improvement in induction characteristics when compared to the switch containing wild-type EcR.Low background expression levels in the absence ofligand and high induced expression in the presenceof...
  • 16
  • 454
  • 0
Báo cáo khoa học: Purple membrane lipid control of bacteriorhodopsin conformational flexibility and photocycle activity An infrared spectroscopic study docx

Báo cáo khoa học: Purple membrane lipid control of bacteriorhodopsin conformational flexibility and photocycle activity An infrared spectroscopic study docx

... region containing the charged acidic amino acidsshould produce a strain limiting the mobility of both theamino-acid-containing loops and the attached transmem-brane a-helices. These interactions ... twists in the retinal structure and changes in its environment induced by a bacteriorho-dopsin conformational change, which produces alteredprotein–retinal interactions [25], while the decrease in ... 2MNaCl (Fig. 1, dash-dotline).Examination of the lineshape features of an infrared-active spectroscopic feature, such as the peak heights and bandwidths, provides insights into the molecular dynamicsof...
  • 6
  • 333
  • 0
Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc

Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc

... shape. In aqueous buffer, the CD spectraof the GGN4 analogues, including the native GGN4,showed a strong negative band near 200 nm and a weak and broad band around 222 nm, indicating a predominantlyrandom-coil ... structures in the 50% TFE/water mixture (gray lines) was superimposed over that in 500 mMSDS micelles (black lines), by matching the backbone atoms in residues I2V18,andthemainchain(N,Ca,C¢, and ... 5. Fluorescence quenching and blue shift. Fluorescence emissionspectra of NATA (a and b) and D16W-D24)37GGN4 (c and d) in water (a and c) and in 10 mMSDS micelles (b and d) were measuredwith...
  • 8
  • 447
  • 0
Báo cáo khoa học: Starch-binding domains in the CBM45 family – low-affinity domains from glucan, water dikinase and a-amylase involved in plastidial starch metabolism pptx

Báo cáo khoa học: Starch-binding domains in the CBM45 family – low-affinity domains from glucan, water dikinase and a-amylase involved in plastidial starch metabolism pptx

... 2011)doi:10.1111/j.1742-4658.2011.08043.xStarch-binding domains are noncatalytic carbohydrate-binding modulesthat mediate binding to granular starch. The starch-binding domains from the carbohydrate-binding module family ... 1185Starch-binding domains in the CBM45 family – low-affinitydomains from glucan, water dikinase and a-amylaseinvolved in plastidial starch metabolismMikkel A. Glaring1,2, Martin J. Baumann1, ... starch-binding capacityof the noncatalytic SBD2 region and the interactionbetween the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III from Arabidopsis...
  • 11
  • 634
  • 0
Báo cáo khoa học: Ion-binding properties of Calnuc, Ca2+ versus Mg2+ – Calnuc adopts additional and unusual Ca2+-binding sites upon interaction with G-protein pdf

Báo cáo khoa học: Ion-binding properties of Calnuc, Ca2+ versus Mg2+ – Calnuc adopts additional and unusual Ca2+-binding sites upon interaction with G-protein pdf

... dye (attenuating boththe J-band and the c-band), indicating that the dyebinds in the EF-hand motif. Binding of Mg2+causeda decrease only in the c-band, without disturbing theJ-band (Fig. 7A). ... upon binding with GDP-bound G-protein,whereas an increase in the J-band intensity was elicitedupon interaction of Calnuc and GTP-bound G-protein(Fig. 8B). Interestingly, why G-protein binding ... Ca2+-binding and Mg2+-binding thermograms before analysis of the datawith microcal origin 7.0.Protein–protein interactions and dissociation constantswere determined from the binding isotherm...
  • 18
  • 333
  • 0
Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc

Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc

... operonencoding a proline dehydrogenase and a proline perm-ease [23]. PutR has been suggested to facilitate theDNA binding of CRP by direct protein–protein inter-action or to induce a change in DNA ... SenRbinding, EMSAs were done. For this purpose, a  100 bpfragment (containing or lacking binding site I) upstream offurS (up-furS2) was amplified from each of the correspond-ing plasmids, using ... of hbpS and ending at the 5¢-end of binding site III)F IIIEcofor GCCGAATTCCGCCGGACCGGATG (located upstream of hbpS and beginning at the 3¢-end of binding site III)IIPstrev For sequence and characteristics,...
  • 14
  • 428
  • 0
Báo cáo khoa học: Alternative binding proteins: Affibody binding proteins developed from a small three-helix bundle scaffold potx

Báo cáo khoa học: Alternative binding proteins: Affibody binding proteins developed from a small three-helix bundle scaffold potx

... theKeywordsaffibody binding proteins; affinitychromatography; combinatorial proteinengineering; in vivo imaging; peptidesynthesis; phage display; protein chips;protein–protein interactions; selection; ... immunoglobu-lin-binding [Fc binding (IgG) and Fab binding(VHIII)] bacterial receptin have, for several decades,been widely used for the detection and purification ofantibodies from different sources. In ... residues, and canbe easily expressed in soluble and proteolytically stable forms in various host cells on its own or in fusion withother protein partners [6]. Inspiration from advances in protein...
  • 9
  • 307
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ