Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... primer and probe1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT2fw ATCCCAGGAAACACCAGTAGA10rev ATTGTTTTCTCTCAAGACCCAATaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG18Sfw CGCCGCTAGAGGTGAAATTC18Srev TCTTGGCAAATGCTTTCGCTTaqMan ... kit (Stratagene, La Jolla,CA, USA). Mutagenic primers were: 5¢-CGCTCGAGATGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCTATTCTACCAAAAGAATGGCC-3¢ and its ... fw, forward; rev,reverse.SequenceACMSD cloning: primer1fw CGCTCGAGATGAAAATTGACATCCATAGTCAT11rev AAAGCTGAGCTCCATTCAAATTGTTTTCTCTCAAG4fw TTCTCGAGATGGGAAAGTCTTCAGAGTGGTACMSD real-time...

Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of ﬂavonol synthase from Citrus unshiu pptx

... majus, Bromhaedia ﬁnlaysonia, Arabidopsis thaliana, Persea americana,Ipomea purpurea, Ipomea nil and Medicago sativa), three anthocyanidin synthases (Zea mays, Anthirrhinum majus and Oryza sativa), ... doi:10.1046/j.1432-1033.2002.03108.xSeveral intermolecular dioxygenases, particularly those of microbial or human origin, catalyze reactions of medicinal and industrial relevance, and their spatial organization and mode of action are ... Oryza sativa), ﬁve gibberellinC20 oxidases (Arabidopsis thaliana, Cucurbita maxima, Pisum sativum, Spinacia oleracea and Marah macrocarpa), hyoscyamine 6b-hydroxylasefrom Hyoscyamus niger,...

Tài liệu Báo cáo khoa học: Puriﬁcation and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... 275–283.10 Kuwada M, Teramoto T, Kumagaye KY, Nakajima K,Watanabe T, Kawai T, Kawakami Y, Niidome T,Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin-TK containing D-serine at position 46, but ... 2008)doi:10.1111/j.1742-4658.2008.06352.xCone snails, a group of gastropod animals that inhabit tropical seas, arecapable of producing a mixture of peptide neurotoxins, namely conotoxins,for defense and predation. Conotoxins are mainly ... Kubota I, Takao T, Shimonishi Y,Yasuda-Kamatani Y, Minakata H, Nomoto K,Muneoka Y & Kobayashi M (1991) Fulicin, a novelneuropeptide containing a D-amino acid residueisolated from the ganglia...

Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc

... shortest functional domain from a crenarchaeal plasmid endowed withDNA and RNA synthesis and terminal transferase activity.AbbreviationsAEP, archaeo-eukaryotic replicative primases; dNTP, deoxyribonucleotide; ... replicative primases (AEPs) [11].Primase–polymerases (prim–pols) are a novel family of AEPs which are sporadically found in both bacterio-phages and crenarchaeal and Gram-positive bacterialplasmids. ... proteins. The prim–pol domain and putative heli-case ⁄ NTPase domain are indicated in gray and black respectively.(B) Puriﬁcation of the recombinant Rep245 protein. SDS ⁄ PAGE of protein extracts...

Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

... assubstrate in PCR with the following Ras-GRF1 gene-speci-ﬁc primers: ON357, 5¢-TGAAACATCACCAACTAAATCTCCAA-3¢; ON358, 5¢-GACGACTCCATTGTTATAGGAAAAGAGT-3¢; ON359, 5 ¢-GCCGCTGGAGAAACAGCAT-3¢; ON360, ... can inducethe activation of intracellular cascades such as themitogen-activated protein (MAP) kinase – also calledextracellular signal-regulated kinase (ERK) – cascade.The serine ⁄ threonine ... through a cascade thatincludes the proline-rich tyrosine kinase, Pyk2, Src and Grb2 [4,5], as well as Ras GEFs of the Ras-GRP (cal-DAG-GEF) family, through binding of Ca2+⁄ calmo-dulin (CaM) and...

Tài liệu Báo cáo khoa học: Structure determination and biochemical studies on Bacillus stearothermophilus E53Q serine hydroxymethyltransferase and its complexes provide insights on function and enzyme memory doc

... D not containing glycine and FTHF. Such an enzyme was once again incubated with glycine (10 mM) and differ-ent concentrations of FTHF as in (j) and the absorbance was mea-sured at 500 nm. ... is at a distance of 2.95 A ˚from the a- carbon atom of Gly and appears to be suitable for this proton transfer. As theinternal and external aldimines of SHMTs have simi-lar visible absorbance ... Gupta A, Jala VR, Saravanan P, Rao GS,Rao NA, Savithri HS & Subramanya HS (2002) Crystalstructure of binary and ternary complexes of serinehydroxymethyltransferase from Bacillus stearothermophi-lus:...

Tài liệu Báo cáo khoa học: Helix mobility and recognition function of the rat thyroid transcription factor 1 homeodomain – hints from 15N-NMR relaxation studies pdf

... overlapaffecting the corresponding signals. Correlations were calculated bymeans of MATHEMATICA 5.2 software, using the relaxation datasetgiven in supplementary Table S2. Relaxation data obtained ... Universita`di Udine, ItalyHomeodomains (HDs) comprise a very well-knownclass of DNA-binding domains occurring in a largefamily of transcription activators involved in thedetermination of cell ... factor 1 homeodomain – hints from15N-NMRrelaxation studiesDevrim Gu¨mral, Luana Nadalin, Alessandra Corazza, Federico Fogolari, Giuseppe Damante,Paolo Viglino and Gennaro EspositoDipartimento...

Tài liệu Báo cáo khoa học: The antibacterial and antifungal properties of trappin-2 (pre-elaﬁn) do not depend on its protease inhibitory function pptx

... N-terminal domain and is comparable to that of human defensins and human lysozyme.Elafin and trappin-2 are both antimicrobial againstS. aureus and P. aeruginosa [14,15] but not againstE. coli ... analysis of elafin and trappin-2 fractionatedon heparin-Sepharose. The heparin-binding capacities of elafin and trappin-2 were evaluated by affinity chromatography using heparin-Sepharose. Elafin ... pneumoniae, Branhamella catarrhalis and thepathogenic fungi A. fumigatus and C. albicans. Ourresults indicate that trappin-2 has a broad antibacte-rial activity and is fungicidal for A. fumigatus...

Tài liệu Báo cáo khoa học: Receptor association and tyrosine phosphorylation of S6 kinases pdf

... phosphatase 2A interacts with the70-kDa S6 kinase and is activated by inhibition of FKBP12-rapamycinassociated protein. Proc Natl AcadSci USA 96, 4438–4442.11 Petritsch C, Beug H, Balmain A & ... stimulated forvarious times, ﬁxed and stained with an antibodyagainst the C-terminus of S6K1. Using an ﬂuorosceinisothiocyanate (FITC)-labeled secondary anti-rabbitIgG and phalloidin to stain actin, ... ⁄ Akt), protein kinase C (PKCs), p90 ribosomalS6 kinase and 3-phosphoinositide-dependent proteinkinase-1 (PDK1). AGC kinases share a high homology in their kinase domains and have a similar...

Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt

... Helena Yusuf-Makagiansar3, Vincent T. K. Chow2, Teruna J. Siahaan3 and Seetharama D. S. Jois11Department of Pharmacy and 2Department of Microbiology, National University of Singapore, Singapore;3Department ... T-leukemia and the human colonadenocarcinoma (Caco-2) cell lines were obtained from theAmerican Type Culture Collection (Rockville, MD, USA).Jurkat and M OLT-3 cells were maintained in suspension in RPMI1640 ... 10% (w/v) heat-inactivated fetal bovine serum and 100 mgÆL)1 of penicillin/streptomycin. Caco-2 cells were maintained in minimumessential m edium -a containing 10% (w/v) f etal bovineserum,...

Xem thêm