0

writing in the midst of a storm how to deal with bad news and negative publicity

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

Hệ điều hành

... dirty pages • Data manager floods the cache This is rather similar in nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious ... another thread in that task • Server tasks which cannot tolerate changing data, or which must ensure that all of the necessary data is available, may use a separate thread to copy that data to ... modify a page of data at a time An attempt by a reader to write previously read data causes a memory fault which converts a reader into a writer and invalidates all other page caches A subsequent attempt...
  • 23
  • 1,290
  • 1
Báo cáo y học:

Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"

Y học thưởng thức

... 2003 The study included the data obtained from all of the four university hospitals, and one referral tertiary-care educational state hospital in Ankara These hospitals have a total of 6668 beds ... on the antibiotic use, financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, ... consumption of piperacillin-tazobactam after the NARP, the resistance rates of E.coli and Klebsiella spp against piperacillin-tazobactam did not increase significantly (rho:0.626, p=0.096 and rho:0.357,...
  • 6
  • 692
  • 0
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model

Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model

Kinh tế - Thương mại

... attitudinal aspects of individuals An in- depth analysis in each of the broad parameters revealed the following: Educational Facet Education plays a vital role in shaping up a personality and enabling ... borrowers If the income and savings of the individual is high then he/she is least attracted to debt financing On the other hand, the individual with low income and savings is more attracted towards ... data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower income populations towards regulated microfinance...
  • 23
  • 552
  • 0
Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

Tâm lý - Nghệ thuật sống

... inflicting unhappiness onto others We can only achieve happiness by giving happiness to others, and sharing in their happiness ABUNDANCE People with an attitude of abundance are generally charitable ... Sculptor 3, an amazing software that can make affirmations work for anyone, has this to say about affirmations: “By definition, an affirmation is a statement repeated time and again either verbally ... faith – faith in the teachings and achievements of all the great ancient sages and mystics, faith in the universality of their teachings and faith in our own divinity And why should we not have such...
  • 59
  • 770
  • 3
Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx

Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx

Kỹ năng bán hàng

... making, and their satisfaction contribute towards the satisfaction of the customer organization as a whole In this case, the measurement of CS includes the identification of key individuals and ... employee quality training and pervasiveness of the quality management system An important advantage of CIT and SIT is the usability of the data gathered with them for improving service levels (Edvardsson ... and organizational levels These individual are not aware of all aspects of the project work that influences customer satisfaction This makes it difficult to create one standardized way of measuring...
  • 37
  • 1,063
  • 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

Báo cáo khoa học

... vector expressing hamster ESSS-HA The blots were probed with antisera against HA, with anti-porin, and with two other antisera against complex I proteins (MWFE and PSST) (B) BN/PAGE Top panel: ... the matrix The mature hamster protein has 122 residues of which 55 at the N-terminus are predicted to form a domain on the matrix side, and 36 form a domain extending into the intermembrane space ... Each of the mutants was found to have a premature chain-termination codon within the open reading frame In two of the mutants (CCL16-B11 and V79-G18) the predicted protein is truncated at a position...
  • 9
  • 622
  • 0
Tài liệu In the Shadows of a Fallen Wall docx

Tài liệu In the Shadows of a Fallen Wall docx

Ngân hàng - Tín dụng

... concrete barricades installed a few days later In addition to the inaccuracy of referring to the two walls as a singular entity, to speak of the Wall as simply a wall is also incorrect In reality, the ... to. ” In actuality, this conversation never took place Because of the weather, seating was abundant and the table next to us that evening was empty And it was because of the weather that the Lindes ... memories are of viewing seminal national events: the first moon landing, the Viet24 BUT FOR THE WEATHER nam War, and the Watergate hearings While the moon landing produced the sort of cheering and...
  • 208
  • 481
  • 0
Incidents in the Life of a Slave Girl Written pdf

Incidents in the Life of a Slave Girl Written pdf

Du lịch

... home; and what added to my unhappiness, was the fact that my brother William was purchased by the same family My father, by his nature, as well as by the habit of transacting business as a skillful ... called Aunt Nancy, was also a slave in his family She was a kind, good aunt to me; and supplied the place of both housekeeper and waiting maid to her mistress She was, in fact, at the beginning ... slaves? I have spoken of the pains slaveholders take to give their slaves a bad opinion of the north; but, notwithstanding this, intelligent slaves are aware that they have many friends in the...
  • 196
  • 462
  • 0
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

Báo cáo khoa học

... molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular mass of 87 392 Da The total calculated average molecular mass of the heterotetrameric (a2 b2) ... (5¢-gccgcccatatgcaccaccaccaccaccacagcaccagtca gaactct), the reverse primer xa100– (5¢-gtggtgaattcagc cagtgtgcccttg), and pNIall2 as a template To facilitate purification of recombinant enzyme, the xb101+ ... and characterization of xanthine dehydrogenase in a baculovirus-insect cell system In Flavins and Flavoproteins 1993 Proceedings of the 11th International Symposium on Flavins and Flavoproteins...
  • 11
  • 584
  • 0
Báo cáo Y học: Expression pattern in the antennae of a newly isolated lepidopteran Gq protein a subunit cDNA potx

Báo cáo Y học: Expression pattern in the antennae of a newly isolated lepidopteran Gq protein a subunit cDNA potx

Báo cáo khoa học

... homogenates of male and female antennae contained an immunoreactive band with an apparent molecular mass of 40 kDa (Fig 1, left, A, B) In the sample of primary cell culture of M brassicae, a band with ... sequence analysis revealed that the cDNA contains a putative coding region of 1059 bp, encoding a 353 amino-acid protein with a theoretical molecular mass of 41 400 Da and an isoelectric point of 5.35, ... characteristics, the molecular cloning of the corresponding cDNA to get the total amino-acid sequence of the protein, and the expression pattern of the corresponding mRNA as a first step to clarify the role of...
  • 10
  • 619
  • 0
Báo cáo khoa học: Kinetic analysis of zymogen autoactivation in the presence of a reversible inhibitor pptx

Báo cáo khoa học: Kinetic analysis of zymogen autoactivation in the presence of a reversible inhibitor pptx

Báo cáo khoa học

... equation is applicable to both tight and loose binding inhibitor As an example, Eqn (21) was used to analyze the effects of acetamidine, p-amidinobenzamidine and benzamidine on the autoactivation ... completion in each case As the autocatalytic activation of trypsinogen is quantitative, the increase in trypsin activity shows the appearance of newly processed trypsin during the reaction, and the ... straight line, indicating that p-amindinobenzamidine is a competitive inhibitor for the trypsinogen autoactivation reaction From the slope and intercept of the straight line, the kinetic parameters...
  • 8
  • 403
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Current Research in the Development of a Spoken Language Understanding System using PARSEC*" ppt

Báo cáo khoa học

... feedback about impossible word candidates • We have been able to incorporate the durational information from Bear and Price quite easily into our framework An advantage of our approach is that the ... prosodic information is added as constraints instead of incorporating it into a parsing grammar Because CDG is more expressive than context-free grammars, we can produce prosodic rules that are more ... processing time is incremented by this amount In contrast, Bear and Price, by doubling the size of the grammar are multiplying the processing time by a factor of when no prosodic information is available...
  • 2
  • 359
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response" pptx

Hóa học - Dầu khí

... ELISA-assay remained negative throughout follow-up in of the seven cases (Table 1) We also investigated reactivity against single HCV proteins by the INNO-LIA HCV III assay A faint band against the ... hepatitis with about ten times elevated ALT levels A robust response against HCVhelicase was found in the proliferation assay at baseline and after clearance of HCV-RNA (SI values of 4.1 and 3.6, ... proteins) (*) Patient 13 had a faint band against the C2 protein at the second time point investigated (after HCV clearance) (**) Patient 80 had HCV serotype Genotyping was not performed in the initial...
  • 11
  • 528
  • 0
báo cáo hóa học:

báo cáo hóa học: " Cognitive interviewing methodology in the development of a pediatric item bank: a patient reported outcomes measurement information system (PROMIS) study" docx

Hóa học - Dầu khí

... that children ages 8–17 can talk about and respond to items asking them about their health and well-being They can also offer unique insight into the understandability of the items These findings ... all aspects of their health and well-being in meaningful ways They are able to comprehend varying response options on a categorical scale, and can accurately respond to items using a 7-day recall ... two others interpreted it as doing something "bad" that was worthy of punishment., and the remaining children defined it as "feeling bad" and "my life has been bad. " There was a significant degree...
  • 10
  • 480
  • 1
Báo cáo sinh học:

Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

Điện - Điện tử

... recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the lower fitness of the ... draft the manuscript AlexP participated in the design of the study and drafted the manuscript Both authors read and approved the final manuscript Acknowledgements 18 19 The authors thank Prof ... used To monitor the presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To...
  • 5
  • 483
  • 0
báo cáo hóa học:

báo cáo hóa học: " Application of a hybrid wavelet feature selection method in the design of a self-paced brain interface system" pptx

Hóa học - Dầu khí

... process was as follows For each subject, IC and NC epochs were randomized and divided into training, validation and test sets The training set was used to train the classifier, and the validation ... training set data were calculated Then, using histograms with 10 bins each, the probability function of each feature was estimated and its mutual information with each of the output classes was ... protocol, the same EEG data and the same evaluation protocol The LF-ASD (originally reported in [3] and later modified as reported in [42]) uses a feature extractor with a shape similar to a wavelet...
  • 13
  • 530
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response" potx

Hóa học - Dầu khí

... ELISA-assay remained negative throughout follow-up in of the seven cases (Table 1) We also investigated reactivity against single HCV proteins by the INNO-LIA HCV III assay A faint band against the ... hepatitis with about ten times elevated ALT levels A robust response against HCVhelicase was found in the proliferation assay at baseline and after clearance of HCV-RNA (SI values of 4.1 and 3.6, ... proteins) (*) Patient 13 had a faint band against the C2 protein at the second time point investigated (after HCV clearance) (**) Patient 80 had HCV serotype Genotyping was not performed in the initial...
  • 11
  • 440
  • 0
báo cáo hóa học:

báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt

Hóa học - Dầu khí

... recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the lower fitness of the ... draft the manuscript AlexP participated in the design of the study and drafted the manuscript Both authors read and approved the final manuscript Acknowledgements 18 19 The authors thank Prof ... used To monitor the presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To...
  • 5
  • 430
  • 0
báo cáo hóa học:

báo cáo hóa học:" Ovarian cancer plasticity and epigenomics in the acquisition of a stem-like phenotype" pptx

Hóa học - Dầu khí

... continuing understanding of the normal mechanisms could reveal the aberrant features that mediate and maintain the transformed state, especially in solid malignancies [87,89,98] miRNA as targets ... selfrenewal in ovarian cancer [116] Targeted therapy to advanced disease and cancer stem cells The rate of mortality in ovarian cancer has changed little in the past three decades [1,2]; drug resistance ... transcriptional inhibitors of oncogene and growth factor signaling Oct4 plays a key role in the maintenance of pluripotency and proliferation potential of stem cells, and siRNA directed against OCT4 induces...
  • 11
  • 555
  • 0

Xem thêm