webtics a web based telemetry and metrics system for small and medium games
Báo cáo y học: "The association between weight loss and engagement with a web-based food and exercise diary in a commercial weight loss programme: a retrospective analysis" pdf
... first and last recorded weight Separate analyses for each engagement variable Covariates as above and all engagement variables included in the model forum use remained non-significant in men All ... dependent variable was percentage weight loss, and initial BMI, and duration of programme use were included as covariates Age was not included as a covariate as it was not associated with percentage ... acknowledged Authors’ contributions FJ planned the analysis strategy, analyzed the data and drafted the article in collaboration at all stages with JW Both authors read and approved the final manuscript...
- 7
- 284
- 0
Báo cáo y học: "yrGATE: a web-based gene-structure annotation tool for the identification and dissemination of eukaryotic genes" pdf
... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 19824860 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGAGGATGACACTTCGGCCGATGAG>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>CAGGATAAGGAGATTGATCTGCCAGAGTCC ... add Clear User-Defined Exons Table mRNA (1802 nucleotides) AGCACCGCGCAGGCGCTGCGGAGCCGCGCGGAGGAAGTTTGAACG GTGGCGGGTACCGGAGCCGCTGATGGAGTCCGTGCTGAAAGGTAT ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA...
- 11
- 467
- 0
Báo cáo " A web-based decision support system for the evaluation and strategic planning using ISO 9000 factors in higher education " pot
... and plan for a strategy in educational management of organizations in Vietnam and Asia [3] However, there are no DSS applications to apply a real case in the domain of an evaluation and a strategic ... standards have been adopted by more than 74 countries as national standards for quality assurance The representative of ISO for the USA is the American National Standards Institute (ANSI) and ... education and training [2,6] In addition, ISO 9000 is a series of generic international standards developed by the International Organization for Standardization for Quality Management and Quality...
- 12
- 541
- 0
Development and application of a web based kanban system
... for a manufacturing company that aims to improve and enhance their manufacturing system and operations The major advantages of a Web- based Kanban system is the availability of visible and real-time ... develop a Web- based Kanban system for repetitive assembly manufacturing II To develop a Web- based software application to support the Web- based Kanban system model III To implement and perform a case ... Similar to a withdrawal Kanban except that that the retrieval of Subcontract Kanban materials is from a factory or storage location near the actual manufacturing plant Express Kanban Auxiliary Kanban...
- 78
- 391
- 1
A web-based system for notifying environment violation.doc
... operating system - Easy to manage, update database: Database is located at dedicated server that managers can maintain and update it easily - Quick delivery: web- based model make it portable ... Geographic Information system (GIS) is any system integrates hardware, software, and data for capturing, managing, analyzing, and displaying all forms of geographically referenced information ... higher performance Most of web applications today use Relational Database Management System (RDBMS) using Structure Query Language (SQL) to store and manipulate data logic There are many available...
- 56
- 410
- 0
10 steps to a results based monitoring and evaluation system
... and maintaining results -based M&E systems has been a particular problem for participating HIPC countries such as Albania, Madagascar, and Tanzania • International Development Association (IDA) ... information and data, and start to build an M&E system For example, a recent assessment found that capacity building for key national officials in results -based M&E and performance -based budgeting ... this direction Establishing a foundation requires basic statistical systems and data, as well as key budgetary systems Data and information must be of appropriate quality and quantity Developing...
- 268
- 2,838
- 0
Báo cáo y học: "ExpressionPlot: a web-based framework for analysis of RNA-Seq and microarray gene expression data" doc
... data Brad A Friedman1,2,3* and Tom Maniatis4 Abstract RNA-Seq and microarray platforms have emerged as important tools for detecting changes in gene expression and RNA processing in biological ... of the Barres Lab (Stanford), Myers Lab (HudsonAlpha Institute), Ravits Lab (Benaroya Institute) and Maniatis Lab (Harvard/Columbia) for providing data and/ or user feedback This work was supported ... [http://www.ebi.ac.uk/ena/ data/view/ERP000619] 28 Affymetrix - Sample Data, Exon 1.0 ST Array Dataset [http://www affymetrix.com/support/technical/sample_data/exon_array_data.affx] 29 Akira S, Takeda K:...
- 12
- 394
- 0
DESIGN AND IMPLEMENTATION OF WEB-BASED DATA AND NETWORK MANAGEMENT SYSTEM FOR HETEROGENEOUS WIRELESS SENSOR NETWORKS
... Unified Gateway UGA Unified Gateway Access VC Virtual Command VCA Virtual Command Attributes x VCAS Virtual Command Attributes Set VCC Virtual Command Category VCS Virtual Command Set VCSMM Virtual ... 3.3.3 Gateway Access Through a series of available files configuring various WSN platforms, their different gateways information and relative gateway middleware information and so on, Gateway Access ... The basic elements are the same, i.e., it can describe fields, platforms, and sensors Additionally, the Atlantis Framework adds data handling abstractions, and a query field for more detailed...
- 104
- 478
- 0
Báo cáo khoa học: "A Web-based Evaluation Framework for Spatial Instruction-Giving Systems" docx
... Tasks and Comparative Evaluation in Natural Language Generation Robert Dale, Sabine Geldof, and Jean-Philippe Prost 2003 CORAL : Using Natural Language Generation for Navigational Assistance In Proceedings ... dialogue systems: Learning and evaluation In Proceedings of Interspeech/ICSLP, pages 1065–1068 54 Harlan Hiley, Ramakrishna Vedantham, Gregory Cuellar, Alan Liuy, Natasha Gelfand, Radek Grzeszczuk, and ... Shared Task Proposal: Instruction Giving in Virtual Worlds In Workshop on Shared Tasks and Comparative Evaluation in Natural Language Generation Rainer Malaka and Er Zipf 2000 Deep Map - challenging...
- 6
- 349
- 0
A SIP-based Medical Event Monitoring System potx
... greater flexible and adaptable information identification It is a “metalanguage”, which is a language used for describing other languages and thus allows for the design of a customized markup language ... way, the language can be read manually by an operator and translated to the specific database query of that institution’s database An obvious drawback to this is that the monitoring system will ... Thus, a doctor enters the Arden Syntax rules he is interested in for a particular patient, via a SIP user agent application, and subscribes to those particular events Another way that this may be...
- 5
- 316
- 0
Báo cáo khoa học: "Building trainable taggers in a web-based, UIMA-supported NLP workbench" potx
... 2002), a suite of text processing and annotation tools, and U-Compare (Kano et al., 2010), a standalone application supporting the UIMA framework that formed the inspiration for Argo Although ... to transform some or all of the annotations and/ or the subject of annotation from the CAS and serialise it into some storable format Readers, analysers and consumers are represented graphically ... Cunningham, D Maynard, K Bontcheva, and V Tablan 2002 GATE: A framework and graphical development environment for robust NLP tools and applications In Proc of the 40th Anniversary Meeting of the Association...
- 6
- 320
- 0
Báo cáo khoa học: "A Web-Based Interactive Computer Aided Translation Tool" potx
... statistical machine translation methods acquire their translation knowledge in form of large phrase translation tables automatically from large amounts of translated texts (Koehn et al., 2003) For each ... computer aided translation tool caitra that allows us to compare industrystandard post-editing, the interactive sentence completion paradigm, and other help for translators The tool is available ... word and phrase translation are displayed alongside the input words, ranked and color-coded by their probability the translation word by word, she is aided by a machine translation system that...
- 4
- 243
- 0
Báo cáo khoa học: "Evaluating Response Strategies in a Web-Based Spoken Dialogue Agent" pdf
... DARPA Speech and NL Workshop M Walker, D Litman, C Kamm, and A Abella 1997 PARADISE: A general framework for evaluating spoken dialogue agents In Proc ACL/EACL M Walker, D Litman, C Kamm, and A Abella ... combine all of our data (48 dialogues), and perform a two-way ANOVA for each evaluation measure as a function of strategy and task An interaction between response strategy and task scenario is ... h~terpretation and Generation D Goddeau, H Meng, J Polifroni, S Seneff, and S Busayapongchai 1996 A form -based dialogue manager for spoken language applications In Proc ICSLP A Joshi, B Webber, and...
- 7
- 273
- 0
Báo cáo khoa học: " a Web-based Tool for NLP-Assisted Text Annotation" pdf
... Conference on Natural Language Learning, pages 152–164 Association for Computational Linguistics Hamish Cunningham, Diana Maynard, Kalina Bontcheva, Valentin Tablan, Niraj Aswani, Ian Roberts, Genevieve ... judgement for each annotation As a specific realisation based on this approach, we have integrated a recently introduced machine learning -based semantic class disambiguation system capable of offering ... separate “save” operation and thus a minimal risk of data loss, and as the authoritative version of all annotations is always maintained by the server, there is no chance of conflicting annotations...
- 6
- 335
- 0
báo cáo hóa học: " Initiation of health-behaviour change among employees participating in a web-based health risk assessment with tailored feedback" pptx
... the central HRA database For system security and data protection reasons personal identification data and risk assessment data are stored on separate servers An electronic firewall is placed between ... no, and not applicable Analysis All analyses included descriptive statistics to examine population characteristics, and questionnaire answers for satisfaction and initial health-behaviour change ... indicate that among voluntary participating employees, a web- based HRA program with tailored feedback could motivate those in greatest need of health-behaviour change A web- based HRA with tailored...
- 7
- 538
- 0
báo cáo hóa học: " A scale-based forward-and-backward diffusion process for adaptive image enhancement and denoising" pdf
... camera and tripod This example clearly illustrates that the scale -based classification map readily indicate locations of highly homogeneous, detail and edge regions 3.2 Scale -based forward -and- backward ... this article as: Wang et al.: A scale -based forward -and- backward diffusion process for adaptive image enhancement and denoising EURASIP Journal on Advances in Signal Processing 2011 2011:22 Page ... threshold: a smaller gradient is diffused and positions with larger gradient are treated as edges The P-M equation has several practical and theoretical drawbacks As mentioned by Alvarez et al [20],...
- 19
- 436
- 0
Teaching in a Web Based Distance Learning Environment: An Evaluation Summary Based on Four Courses pdf
... of web page layout and design HCI-2 Clear organization and presentation of information HCI-3 Consistent and easy to use web site navigation HCI-4 Aesthetically pleasing design and graphics Evaluation ... standard information on each page The following basic information should be included at the bottom of each web page: • last update date and time of page • contact information • copyright information ... each topic or assignment and making that person responsible for encouraging and 17 Graham, Cagiltay, Craner, Lim, & Duffy: Teaching in a Web Based Distance Learning Environment stimulating quality...
- 26
- 219
- 0
Báo cáo y học: "Snow Control - An RCT protocol for a web-based self-help therapy to reduce cocaine consumption in problematic cocaine users" pps
... or a professional from Page of the medical advisory and emergency list that will be accessible at all times and how to make this contact The participants will also be informed that the study has ... Table Inclusion and exclusion criteria and reasoning Inclusion Criteria Reasoning - Minimal age of 18 years To ensure a minimal age of participation - Cocaine use > occasions in the last 30 days ... the data analyses and counted as dropout (cut-off: answered at least 70% of the questions) Data Analysis Data will be analysed according to the intention-to-treat principle Multiple imputations...
- 7
- 401
- 0
Báo cáo y học: "GSMN-TB: a web-based genome-scale network model of Mycobacterium tuberculosis metabolism" ppsx
... growth and pathogenesis, and are important drug targets Because fatty acid metabolism is thought to be a crucial factor in TB pathogenesis [23], standard biochemical pathways for β-oxidation of fatty ... associations, rather than being modeled by duplication of reactions (see Materials and methods) The reaction formulae, FBA parameters, and geneprotein associations are summarized in Additional ... maximal theoretical growth rate, reaction formula, and gene annotation Gene names are linked to genome annotation pages of the TubercuList database The rows of the table are loaded as computation...
- 18
- 308
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25