vi u links and is the number of links in the page
Báo cáo khoa học: Limited mutagenesis increases the stability of human carboxypeptidase U (TAFIa) and demonstrates the importance of CPU stability over proCPU concentration in down-regulating fibrinolysis doc
... for synthetic 784 Fig Thermal unfolding of WT proCPU-CHis and YQ proCPUCHis The thermal unfolding of WT and YQ proCPU-CHis was monitored using the fluorescent dye Sypro orange The unfolding process ... of H355 and ⁄ or H357 in the thermal stability of proCPU Furthermore, we digested WT proCPU-CHis and YQ proCPU-CHis with bovine trypsin (Fig 4), which resulted in the case of WT proCPU-CHis in ... acid sequencing Characterization of purified WT and mutant proCPUs SDS ⁄ PAGE was carried out using 4–12% Bis-Tris Gels (NuPAGETM, Invitrogen) according to the manufacturer’s instructions The concentration...
- 15
- 397
- 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... where A and B are the MICs of drug A and drug B in the combination, MICA and MICB are the MICs of drug A and drug B alone, FICA and FICB are the FICs of drug A and drug B and n is the number of wells ... (0.1–2 lm) was injected into the subphase, and the increment in surface pressure of the LPS film upon intercalation of the peptide dissolved in the subphase was monitored for the next 37 The difference ... reference, the MIC of Esc(1–18) in culture medium (Mueller–Hinton broth) was found to be directly correlated with the number of microbes present in the inoculum Afterwards, to examine the killing activity...
- 18
- 494
- 0
báo cáo khoa học: "Note Selection for increased and decreased total number of young born in the first three parities in mice" doc
... decrease in the size of the 2nd, 3rd and following litters below the control line That result was attributed to an effect of overloading in the uterus caused by shorter litter intervals combined ... estrus occurrence and the total number of lambs born per ewe over the first three lambings All these results suggest that indirect selection for high fertility in the L- line may have been opposing ... the total number of young born alive in the first three parities (TNY-3) The third line (C) served as an unselected control Selection was carried out over 13 generations on the basis of individual...
- 8
- 287
- 0
Seawater Purification Experiment and Consideration about Photoreactivation of Coliforms in the Inside of Seawater
... coliforms, the number of fecal coliforms clearly increased after the rain due to the influence of CSO The influence of CSO occurred predominantly after the rain rather than during the rain and depending ... not detected in the purified seawater, and the UV disinfection was found to be sufficient for inactivation Referring to CODMn , the low values found in the raw water quality during the experimental ... a double fence structure consisting of dropping and raising curtain oil fences The fences are "silt fences," which are used for offshore works, each having curtains that allow the passage of water,...
- 8
- 388
- 0
Báo cáo khoa học: Hodgkin Reed–Sternberg cells express 15-lipoxygenase-1 and are putative producers of eoxins in vivo Novel insight into the inflammatory features of classical Hodgkin lymphoma ppt
... constitute only a small minority (approximately 1%) of the cell population in HL-affected tissue The in ammatory cellular in ltrate in HL tumour tissue is rather heterogeneous, consisting of lymphocytes, ... Patient and tumor characteristics The degree of eosinophilia and the number of H-RS cells in HL tumors were determined by random selection of 10 consecutive HPFs In each HPF, the number of eosinophils ... allows, and probably promotes, the survival of H-RS cells [2] Cytokines and chemokines operating in a complex interaction have been suggested to be involved in the pathogenesis of HL [3] A number of...
- 13
- 350
- 0
báo cáo hóa học: " The longitudinal link between visual acuity and health-related quality of life in patients with diabetic retinopathy" doc
... examination (including slit-lamp biomicroscopy, intraocular pressure, and ophthalmoloscopy) at screening and each study visit Visual acuity was quantified in terms of number of letters as measured by the ... Institute, New England Medical Center; 1993:11-11 Rubin GS, Munoz B, Bandeen-Roche K, West SK: Monocular versus binocular visual acuity as measures of vision impairment and predictors of visual disability ... between visual acuity and HRQL at one point in time has been well established, little is known about this link over time Thus, the purpose of the current study was to examine the degree of change in...
- 10
- 523
- 0
báo cáo hóa học:" Prevalence of visual impairment in relation to the number of ophthalmologists in a given area: a nationwide approach" ppt
... Classification of Diseases, Injuries and Causes of Death, visual impairment includes both low vision and blindness Low vision is defined as visual acuity less than 6/18, but equal to or better ... based on the latter survey For the institution survey, weights included size of strata, the institution occupation rate (number of subjects in the institution /number of available beds), and the answer ... identified the risk factors for blindness (blind versus no visual impairment) and another the risk factors for low vision (low vision versus no visual impairment) The reference state was "no visual...
- 8
- 445
- 0
báo cáo hóa học:" The longitudinal link between visual acuity and health-related quality of life in patients with diabetic retinopathy pot
... examination (including slit-lamp biomicroscopy, intraocular pressure, and ophthalmoloscopy) at screening and each study visit Visual acuity was quantified in terms of number of letters as measured by the ... Institute, New England Medical Center; 1993:11-11 Rubin GS, Munoz B, Bandeen-Roche K, West SK: Monocular versus binocular visual acuity as measures of vision impairment and predictors of visual disability ... between visual acuity and HRQL at one point in time has been well established, little is known about this link over time Thus, the purpose of the current study was to examine the degree of change in...
- 10
- 474
- 0
Báo cáo nghiên cứu khoa học " MAINTAINING FRUIT QUALITY AND INCREASING SHELF LIFE OF POMELO IN THE MEKONG DELTA OF SOUTHERN VIETNAM " pot
... Diplodia and Phomopsis and occur in regions with a high rainfall Lesions of the fruit become dark, leathery and sunken and the fungus grows through the centre of the fruit causing considerable internal ... breakdown and a reddish brown discolouration Several other diseases originate during the post-harvest handling phase These diseases enter through wounds acquired during the harvesting, handling, packing ... Vitamin C content of the pomelo juice Fructose one of the major sugars found in orange juice, can also cause Vitamin C breakdown The higher the fructose content the greater the loss of Vitamin...
- 38
- 485
- 0
Báo cáo toán học: "An improved bound on the minimal number of edges in color-critical graphs" pot
... k − Then the number of connected components of its high-vertex subgraph H(G) does not exceed the number of connected components of its low-vertex subgraph L(G) Proof of Theorem Let L(G) and H(G) ... treatment of the problem, containing lower and upper bounds on the minimal number of edges in a k-critical graph on n vertices with additional restrictions imposed, and some applications of these bounds ... definitions and notation (we follow the terminology of [4]) If G = (V, E) is a k-critical graph, then the low-vertex subgraph of G, denoted by L(G), is the subgraph of G, induced by all vertices of degree...
- 4
- 344
- 0
Báo cáo toán học: "A LOWER BOUND FOR THE NUMBER OF EDGES IN A GRAPH CONTAINING NO TWO CYCLES OF THE SAME LENGTH" pptx
... vertices, and (G) denote the number of edges In this paper, we construct a graph G having no two cycles with the same length which leads to the following result Theorem Let t = 27720r + 169 (r ≥ 1), then ... Combining this with Boros, Caro, F¨ redi and Yuster’s upper bound, we have u f (n) − n f (n) − n 1.98 ≥ lim sup √ ≥ lim inf √ ≥ 1.5397 n→∞ n n n→∞ lim inf n→∞ the electronic journal of combinatorics ... Acknowledgment The author thanks Prof Yair Caro and Raphael Yuster for sending reference [7] The author also thanks Prof Cheng Zhao for his advice References [1] J.A Bondy and U. S.R Murty, Graph Theory...
- 6
- 477
- 0
Báo cáo toán học: "Bounding the number of edges in permutation graphs" pdf
... the number of edges in Γπ,0 equals the number of permutations σ that are covered by π in the strong Bruhat1 order on Sn , and the number of edges in Gπ,0 equals the degree of the vertex π in the ... every other vertex listed in πn−1 Since n is the largest number, this forces the insertion point to be right at the beginning of the list Since π is s,m precisely πn−1 with m = n−1−s , this yields ... adjacent, the number of diagram points that lie in region A of the diagram is bounded by s Similarly, the number of points in each of regions B, C, D, and E must also be bounded by s The set of common...
- 9
- 381
- 0
Báo cáo toán học: "On the Number of Matchings in Regular Graphs" pptx
... is (nr − m)! Multiply all these choices to get the numerator of the right-hand side of (4.10) Divide this number of choices by the number of permutations of {1, , rn} to deduce the lemma Using ... chosen in nr ways There are three three-edge subgraphs which are not a matching, depicted in Figure The number r of 4-vertex stars, 2n , is counted as in the previous case The number of P4 ’s is ... of m In the expression for φ(G, 4) the number of 4-cycles appeared as the first structure in the graph, apart from n and r, which affects the number of matchings The maximum possible value of a4...
- 28
- 263
- 0
Báo cáo toán học: "The number of elements in the mutation class of a quiver of type Dn Aslak Bakke Buan" pps
... non-isomorphic quivers, thus ∆ = ∆′ in (Tn /∼) Corollary 5.8 The number d(n) of elements in the mutation class of any quiver of type Dn is equal to the number of triangulations of the punctured ... a punctured n-gon, up to rotation and inversion of tags This is a generalization of the method used in [T] to count the number of elements in the mutation class of quivers of Dynkin type ... from the root of T The mutation of T at x and y is a new tree obtained in the following way Disconnect the full subtree of T containing x and y Add an edge v1 from the root and connect the subtree...
- 23
- 300
- 0
Báo cáo toán học: "Counting the number of elements in the ˜ mutation classes of An −quiver" ppt
... Additionally, we obtain the number of quivers in the mutation class of a quiver of Dynkin type Dn This formula was first determined in [5]: Corollary The number of quivers of type Dn , for n ≥ 5, is given ... sum, instead of the three-fold sum stated in the main theorem Finally, at the end of Section we prove the formula for the number of quivers in the mutation class of type Dn , by exhibiting an ... author in [2] The purpose of this paper is to give an explicit formula for the number of ˜ quivers in the mutation classes of quivers of type An−1 ˜ A cluster-tilted algebra C of type An−1 is...
- 23
- 271
- 0
Báo cáo y học: "Disability and health-related quality of life in outpatients with generalised anxiety disorder treated in psychiatric clinics: is there still room for improvement" pdf
... population of chronic pain in the Pain in Europe survey was 19% [50], which is in contrast with the 46.7% of patients with GAD suffering pain for the last month in our study The proportion of ... patients in this study separate from the normal population in Spain Also, scoring on the HAM-A scale was evaluated calculating total scoring and punctuation on the HAM-A subscales, as absolute values ... It is composed of two subscales: CGI Severity (CGI-S) and CGI Improvement (CGI-I) In this study, the CGI-S evaluated was assessed by the psychiatrist during the visit/interview The CGI-S consists...
- 9
- 447
- 0
Báo cáo lâm nghiệp: " Effects of long-term water stress on net photosynthesis, growth and water-use efficiency of conifers in the field" doc
... reasons for the high productivity of Douglas fir in central Europe indicating Acknowledgments was supported by Deutsche schungsgemeinsc:haft For- References photosynthesis and growth of young (Picea ... Transpiration and photosynthesis of detached leaves and shoots of Quer cus pubescens and Q ilex during desiccation under standard conditions Bull Res Counc Isr Sect D 213-224 Tyree M.T., Cheung YN.S., ... point, reflecting complete stomatal closure Consequently, the reduction of net photosynthesis in trees with limited and very limited water supply was more pronounced in summer than in autumn species...
- 5
- 323
- 0
báo cáo khoa học: " Discovery of microvascular miRNAs using public gene expression data: miR-145 is expressed in pericytes and is a regulator of Fli1" pps
... UUCCCUAAGGACCCUU UUGACCUG ||| ||||||| 5' UCA-AUUCAGUGGAUGGCAACUGGAA 5' CAA-AUUCAGUGGAUGGCAACUGGAA 5' UUA-AUUCAGCGGAUGGCAACUGGAA 5' AUAUAUUCAGUGGAUGGCAACUGGAA (b) 3' UUCCCUAAGGACCCUUUUGACCUG || |||||| 5' UUAAAUAUUUAGGUU ... UUAAAUAUUUAGGUU ACUGGAA 5' UUGCAUAUUAAGAUU ACUGGAA 5' UUAAAUAUUUAGGUU ACUGGAA 5' CUGAAUCUUUAGAUU ACUGGAA Volume 1, Issue 11, Article 108 control No significant reduction was observed (Figure 5f) ... Site : Fli1 3’ UTR pos 490-497 3' UUCCCUAAGGACCCUUUUGACCUG || ||||||| 5' UGAAGUUUUUUGCCC-AACUGGAA 5' UGAAG-UUUUCACCC-AACUGGAA 5' UGAAG-UCCCUGCCC-AACUGGAA 5' UGAAG-UUUUCACCC-AACUGGAA 5' 3' 3'...
- 12
- 242
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25