0

transgenic adenocarcinoma of the mouse prostate a validated model for the identification and characterization of m

Báo cáo sinh học:

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

Điện - Điện tử

... TTTGACCTGGAGACTATGttymgngartayaa ACCTTCATCAAAAATCCCttnggnggnatgyt GACGACCGCAGCGTGTGCGTGaaygtnttyggnca TAAAAGTACAGCTCCTGCCCGaanacrttnacrca TTAGCTACTCCGTGGAGCagyttrtcraarta GAAGTGGCAGTTGGAGAGGCTGACCTCCcartcncc ... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... GTTTTTGATTTCCAAAGTTTGTATCCAAGTATTATGATGGCTCATAATCTGTGT RhCMV GTGTTTGACTTTGCCAGCCTGTATCCGTCAATTATCATGGCACATAATCTCTGT RFHVMm GTTGTGGATTTTGCTAGCCTTTATCCCAGCATCATGCAGGCCCACAACCTATGT γ AtHV3 GTAGTAGACTTTGCTAGCCTTTACCCAAGTATTATACAAGCTCATAATCTGTGT...
  • 24
  • 604
  • 0
Báo cáo y học:

Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

Báo cáo khoa học

... acknowledge the technical assistance of Patty Sauder for production of the murine monoclonal antibodies, Miranda Ma for assistance in immunohistochemistry, and Keng Wong for samples of cells and synovial ... ProFound [11] and by tandem mass spectrometry (MS/ MS) using Tandem search engine [12,13] The National Center for Biotechnology Information (NCBI) (Bethesda, MD, USA) non-redundant human database ... to the maintenance of synovial inflammation, aggravating the destruction of cartilage and bone and stimulating the development of the pannus Because FLSs can exhibit significant phenotypic changes...
  • 9
  • 489
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A global model for joint lemmatization and part-of-speech prediction" doc

Báo cáo khoa học

... log-probabilities from the tag-set and lemmatizer models Non-local features Our non-local features look, for every lemma l, at all words which have that lemma as the lemma for at least one of their assigned ... respectable The larger improvement for Slavic languages might be due to the fact that there are many more forms of a single lemma and joint reasoning allows us to pool information across the forms ... assignments of all words that have the same lemma l If the tag-set model is better able to predict the tags of some of these words, the information can propagate to the other words If some of them...
  • 9
  • 430
  • 0
Establishment and characterization of a murine model for allergic dermatitis and asthma using dermatophagoides mite allergens

Establishment and characterization of a murine model for allergic dermatitis and asthma using dermatophagoides mite allergens

Tổng hợp

... desorption/ionization time -of- flight MCP-1 monocyte chemoattractant protein MDC macrophage-derived chemokine mg/µg minigram/microgram MHC major histocompatibility complex MIP macrophage inflammatory protein ... hyperresponsiveness, airway inflammation and airway remodeling, features of acute and chronic asthma that resembled human asthma, and these pathological changes could be adoptively transferred with ... profiles (Ramb-Lindhauer C et al., 1991; van Reijsen FC et al., 1992) Animal Dander and Cockroach Allergens Animal dander and cockroach allergens have been studied in association with asthma and allergic...
  • 222
  • 433
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Core strength: A new model for injury prediction and prevention" pptx

Hóa học - Dầu khí

... tasks often require maximal physical performance, [20] thus making them "industrial" athletes The relation between the FMS score and age, rank, tenure and gender was also assessed If a correlation ... We analyzed the correlation between FMS performance and a history of prior musculoskeletal injury from the fire department database, and other selected parameters (age, gender, tenure and rank) ... provide a relatively unbiased estimate of the before and after differences in injuries The authors thank the members of Tucson Fire Department for their participation, and its administration for...
  • 9
  • 468
  • 0
Tài liệu THE ELEMENTS OF BACTERIOLOGICAL TECHNIQUE A LABORATORY GUIDE FOR MEDICAL, DENTAL, AND TECHNICAL STUDENTS pptx

Tài liệu THE ELEMENTS OF BACTERIOLOGICAL TECHNIQUE A LABORATORY GUIDE FOR MEDICAL, DENTAL, AND TECHNICAL STUDENTS pptx

Điện - Điện tử

... Cream, 457—Examination of Cream and Butter, 457—Examination of Unsound Meats, 460—Examination of Oysters and Other Shellfish, 463—Examination of Sewage and Sewage Effluents, 466—Examination of Air, ... growth of some varieties of bacteria and may be either plain (a) or graduated (b) A simple form (Fig 21, c) may be made from 14 cm lengths of soft glass tubing of 1.5 cm diameter The Bunsen flame ... capillary tube and then warm the tube at the gas flame until the wax becomes softened and makes an air-tight joint between the capillary tube and the end of the barrel Fit a rubber teat to the...
  • 666
  • 511
  • 0
The Privatization of Italian Savings Banks – A Role Model for Germany?* doc

The Privatization of Italian Savings Banks – A Role Model for Germany?* doc

Ngân hàng - Tín dụng

... Germany and discuss whether the Italian case can be used as a role model for the reform of the German banking sector Two Stylized Facts The comparison between the Italian and the German banking ... banks, such as Credito Italiano, Istituto Mobiliare Italiano (IMI), and Banca Commerciale Italiana (BCI) The last step in the transformation of the system came in 1998 when the Ciampi law (law ... that only savings banks can guarantee the provision of loans to SMEs Therefore, the Italian reforms may have impaired the availability of SME loans Furthermore, the reforms led to a consolidation...
  • 19
  • 469
  • 0
Báo cáo khoa học:The isolation and characterization of temperature-dependent ricin A chain molecules in Saccharomyces cerevisiae docx

Báo cáo khoa học:The isolation and characterization of temperature-dependent ricin A chain molecules in Saccharomyces cerevisiae docx

Báo cáo khoa học

... Oligonucleotide primers used to amplify the mature ORF of RTA were CP172 5¢-ATATTCCCCAAACAATACCC-3¢ and the antisense primer CP133 5¢-TTAAAACTGTGACGATGGT GGA-3¢ with the TAA termination anticodon shown ... mutants their behaviour to be fully characterized in mammalian and plant systems Experimental procedures Yeast strain, manipulations and growth media Cultures of S cerevisiae strain W303.1C (MATa ... appears likely that RTA (and other toxins that reach the ER lumen) may hi-jack components of the ERAD pathway to reach the cytosol, where a proportion of toxin can refold to a catalytically active...
  • 14
  • 411
  • 0
Báo cáo

Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot

Báo cáo khoa học

... wave  breaking  on  a natural  beach  To  verify  the accuracy  of the numerical  model on  the simulation  of the wave  transformation  on  a natural  beach,  existing  experimental data on the wave dynamics in  ... require  an  excessive  computational  time  and at  the moment  is  not  suitable  for a practical  application.  On  the other hand, based on results of Nadaoka et al  [9], Ting and Kirby [15‐17], it can be estimated  ... point  and provides  adequate  wave  energy  dissipation  after  breaking.  The maximum,  minimum and mean water levels at all points  in  the computational  region  are  also  predicted  by  the ...
  • 11
  • 460
  • 0
Báo cáo khoa học: A kinetic model for the burst phase of processive cellulases pptx

Báo cáo khoa học: A kinetic model for the burst phase of processive cellulases pptx

Báo cáo khoa học

... overview, an experimental study and mathematical modelling Process Biochem 38, 10031018 22 Abramowitz M & Stegun IA (1972) Handbook of Mathematical Functions with Formulas, Graphs, and Mathematical Tables, ... suggest that the models presented here may be useful in attempts to elucidate and rationalize such interrelationships of activity and processivity Materials and methods All mathematical analysis and ... and numerical tting were performed using the software package Mathematica 7.0 (Wolfram Research, Inc Champaign, IL, USA) The substrate in the calorimetric measurements was reconstituted amorphous...
  • 14
  • 572
  • 0
báo cáo hóa học:

báo cáo hóa học: " A cost model for optimizing the take back phase of used product recovery" docx

Hóa học - Dầu khí

... combinations of transportation method and incentive strategy method of advertisement is the optimum method estimated The model predictions for the maximum net profit and optimum values of parameters ... NR and Nmax and in determining the maximum profit at each combination of reward strategy, advertisement method, and transportation method the domain of advertisement cost (W ) and financial incentive ... strategy, transportation method, and advertisement method, we calculated the profit of take back, ψ, as a 2D function of x and W2 and determined the maximum amount of net profit, ψ, and its associated...
  • 15
  • 454
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " A predictive model for the level of sIgA based on IgG levels following the oral administration of antigens expressed in Sacchromyces cerevisiae" pdf

Báo cáo khoa học

... sdohteM dna slairetaM GgI cimetsys dna AgIs lasocum neewteb pihsnoitaler eht gnizylana yb seneg AIIxpa dna AIxpa gnisserpxe )eaisiverec S( eaisiverec secymorahccaS htiw noitazinummi laro na gniwollof ... ,sisylana AgI dna GgI rof desu erew evoba debircsed elpmas dezinegomoh hcae morf nietorp latot fo gm dna ecim dezinummi morf detcelloc ares ecim ,ydobitna tsrif eht sA Co73 ta rh rof )ASB( nimubla ... tneiciffeoc noitalerroC sisylana lacitsitatS )ASU ,eciveD raluceloM( redaer ASILE na gnisu mn 504 ta derusaem saw eulav D.O eht ,erutarepmet moor ta noitabucni fo nim 02 retfA etalp eht ot )ASU ,daR-oiB(...
  • 5
  • 443
  • 0
Báo cáo y học:

Báo cáo y học: "Identification and characterization of the carboxy-terminal region of Sip-1, a novel autoantigen in Behçet''''s disease" docx

Báo cáo khoa học

... subjects, matched for sex and age Immunoscreening of the cDNA expression library A commercially available HMVEC cDNA library (Stratagene, Cambridge, UK) was screened with a pool of sera from of the ... in the design and revision of the study and performed the statistical analysis RP participated in the design and revision of the study AS participated in the analysis and interpretation of data ... design of the study and in the analysis of data and helped to draft the manuscript PM cloned and sequenced cDNA, purified the recombinant protein and helped to interpret the data CA participated...
  • 8
  • 550
  • 0
Báo cáo y học:

Báo cáo y học: " The identification and management of ADHD offenders within the criminal justice system: a consensus statement from the UK Adult ADHD Network and criminal justice agencies" doc

Báo cáo khoa học

... effective and practical arrangements for diversion and treatment for Court users with mental health problems and/ or learning disabilities Probation Services As part of the National Offender Management ... Offender Managers provide interventions, (e.g Accredited Programmes, Employment Training and Education and Community Payback) and monitor their clients’ progress and, while there are national standards, ... that there was a correlation in the improvement of mood symptoms with ADHD symptoms during the treatment process of around 0.8 [28] The nature of the symptoms that improve with stimulant medication...
  • 14
  • 453
  • 0
báo cáo khoa học:

báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx

Báo cáo khoa học

... Sherman D: Ballistic impact to the forehead zygoma, and mandible: comparison of human and frangible dummy face biomechanics, J Trauma 2004, 56:1305-11 Korac Z, Kelenc D, Baskot A, Mikulic D, Hancevic ... 200 mA Analysis The data obtained were stored in a digital format (DICOM) and transferred to a personal computer for further analysis Statistical analyses were performed using the Voxim software ... of injury Mil Med 2006, 171:826-9 Yoganandan N, Pintar FA, Kumaresan S, Maiman DJ, Hargarten SW: Dynamic analysis of penetrating trauma J Trauma 1997, 42:266-72 Yetiser S, Kahramanyol M: High-velocity...
  • 5
  • 573
  • 0
Báo cáo y học:

Báo cáo y học: " A predictive model for respiratory syncytial virus (RSV) hospitalisation of premature infants born at 33–35 weeks of gestational age, based on data from the Spanish FLIP study" pdf

Báo cáo khoa học

... function The elimination of a variable from the analysis was based on a comparison of the discriminant power of the function derived with and without the variable At each stage, the functions for each ... investigation, there were no suitable European datasets available against which the model could be fully externally validated Therefore, to gain a measure of the applicability of the model to other ... in the final analyses External validation of the model presented a challenge as there were no suitable databases in Europe that were available for such a purpose As a surrogate, the model was...
  • 10
  • 390
  • 0
Báo cáo y học:

Báo cáo y học: " A statistical model for the identification of genes governing the incidence of cancer with age" pptx

Báo cáo khoa học

... Number of clones AA actual AA fitted Aa actual Aa fitted aa actual aa fitted Number of clones 3 2 1 Time C 8 D 12 11 10 AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA ... real data are presently available A B 8 Number of clones Number of clones AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted ... Time C 8 D 12 12 AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted 10 Number of clones 10 Number of clones Time 4 2 Time...
  • 9
  • 372
  • 0

Xem thêm

Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose