to form the possessive case of a plural noun not ending in s add
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
... presented in Section Finally, Section discusses the results The output of a HHMM is generated by a process of traversing some sequence of states within the model At each internal state, the automation ... evaluation involves analysing the results over two sets of data The first is a selection of data from CoNLL2004 and contains 8936 sentences The second dataset is part of the Lancaster Treebank ... hierarchical hidden Markov model (PFHHMM) can assign propositions to language texts (grammar parsing) at least as accurately as the HMM This is assignment is a task that HHMMs are generally not well suited...
- 8
- 528
- 0
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt
... thoracic ganglia (diagonally shaded bars) of females The percentage indicates the GSI of the females M (B) indicates the expression pattern of MIH-B in the same tissues in males (N ¼ 5) The lower ... Either simple t-test or anova was used to perform statistical analysis Functional study of MeMIH-B by RNAi Acknowledgements To prepare a DNA template for the synthesis of dsRNA, DNA corresponding ... only to the coding region As the siRNA produced by the endogeneous Dicer (assuming a mechanism similar to the vertebrates) is small, the siRNA has to be specific to cause an effect For example, the...
- 11
- 546
- 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A ... observed curves were tted assuming single phase kinetics (single phase dissociation/ association) The kinetic parameters were calculated from these ts using the BIAEVALUATION software (v2.1, BiaCore) ... injected (analyte) The analyte interacts with the ligand (CP12) to give the association phase, then the analyte begins to dissociate as soon as injection is stopped and replaced by buffer The observed...
- 8
- 494
- 0
Tài liệu 03) Avoid using ''''s to form the possesive of pdf
... Avoid using 's to form the possesive of a noun that does not name a person Instead of: Your foot s bottom is soft and vulnerable to infections, cuts, and bruises Write: The bottom of your ... is soft and vulnerable to infections, cuts, and bruises About author Hans Anderson 2007-Present: Lecturer at FPT Greenwich Programmes, FPT University 2007: M .S. , Computational Mathematics, ... University 2007: M .S. , Computational Mathematics, University of Minnesota 2001: B .A. , Computer Science, Gustavus Adolphus College, Saint Peter, MN ...
- 3
- 585
- 0
Tài liệu How To Use the Six Laws of Persuasion during a Negotiation pptx
... who are these experts? What are their qualifications to make these claims? Do they have a vested interest in selling the company s products or services? In addition, use this Law to establish ... laws in specific situations to your benefit, then your influence over others increases significantly Some of the best masters of the art of persuasion in negotiation are highly successful salespeople ... have to be able to “sell” your ideas in order to make changes in your favor and, in a win-win situation, provide the other side with a fair deal This entails a process that can appeal to the intellect...
- 6
- 500
- 0
Tài liệu How To Use the Six Laws of Persuasion during a Negotiation docx
... who are these experts? What are their qualifications to make these claims? Do they have a vested interest in selling the company s products or services? In addition, use this Law to establish ... laws in specific situations to your benefit, then your influence over others increases significantly Some of the best masters of the art of persuasion in negotiation are highly successful salespeople ... have to be able to “sell” your ideas in order to make changes in your favor and, in a win-win situation, provide the other side with a fair deal This entails a process that can appeal to the intellect...
- 6
- 502
- 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGATAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG...
- 12
- 772
- 0
Greener Events A guide to reducing the environmental impacts of conferences and seminars potx
... waste into landfill and this is not the best or safest approach to dealing with waste It makes good business sense for the venue also if its waste disposal costs associated with your event can ... in the course of planning the event Key Factors The four key factors to consider when organising or supporting events are as follows: Business in the Community There are many ways organisations ... fact that these are the range and type of issues to be addressed in choosing the venue as well as in organising and running the event And finally… don’t forget to tell your delegates that the event...
- 5
- 527
- 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx
... that nitrotyrosine is incorporated as such into the C-terminus of the a- tubulin subunit, by the same mechanism as tyrosine Capability of nitrotyrosinated tubulin to assemble into microtubules in ... nitrotyrosinated tubulin and total tubulin were the same in assembled vs nonassembled fractions (data not shown), indicating that nitrotyrosinated tubulin is indistinguishable from normal tubulin in the ... was the same in both cases (data not shown), indicating that replacement of tyrosine by 3-nitrotyrosine at the C-terminus of a- tubulin is not relevant to the association of carboxypeptidase with...
- 9
- 518
- 0
Báo cáo Y học: The unorthodox histidine kinases BvgS and EvgS are responsive to the oxidation status of a quinone electron carrier ppt
... remains obscure It is interesting to note that the PAS domain of the phosphorelay histidine kinase A of Bacillus subtilis was recently shown to be a catalytic ATP-binding domain [31] As the PAS ... consequence of a decrease in the histidine kinase activity, or, alternatively, of an increase in an intrinsic autophosphatase activity present in the BvgS and EvgS proteins [7,10] To investigate ... relative amount of the phosphorylated histidine kinases was determined by PhosphorImage analysis The figure shows representative autoradiographs of the samples after SDS/PAGE (right panel) and the results...
- 6
- 421
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu