the value of a mixed methods approach in emotional intelligence work with teachers
Báo cáo hoa học: " On the stability of a mixed type functional equation in generalized functions" ppt
... (1941) [3] Rassias, ThM: On the stability of the linear mapping in Banach spaces Proc Am Math Soc 72, 297–300 (1978) [4] Czerwik, S: Functional Equations and Inequalities in Several Variables World ... Stability of Functional Equations in Nonlinear Analysis Springer Optimization and Its Applications Springer, New York (2011) [7] Kannappan, Pl: Functional Equations and Inequalities with Applications ... D: The stability of Cauchy equations in the space of Schwartz distributions J Math Anal Appl 295, 107–114 (2004) [18] Lee, Y-S: Stability of a quadratic functional equation in the spaces of generalized...
- 21
- 299
- 0
A study on the effectiveness of using task-based approach in teaching vocabulary in ESP to the second year students at Construction School N04
... teaching refers to an approach based on the use of tasks as the core unit of planning and instruction in language teaching" (p 223) In task-based approach, learners concentrate on meaning rather ... traditional grammar-translation based approaches 17 On looking back at the literature review, it is obvious that using tasks in teaching is a popular method and applying tasks in teaching vocabulary in ... English Language Teachers As far as we know, vocabulary is an inseparable part of any teaching syllabus and vocabulary should be taught in a well-planned and regular basis It‟s essential to carefully...
- 102
- 760
- 2
Báo cáo hóa học research article a fixed point approach to the stability of a quadratic functional equation in c∗ alg
... Academy of Sciences of the United States of America, vol 27, pp 222–224, 1941 T Aoki, “On the stability of the linear transformation in Banach spaces,” Journal of the Mathematical Society of Japan, ... of Mathematical Analysis and Applications, vol 158, no 1, pp 106–113, 1991 20 Th M Rassias, “On the stability of functional equations in Banach spaces,” Journal of Mathematical Analysis and Applications, ... Rassias, “On the stability of the linear mapping in Banach spaces,” Proceedings of the American Mathematical Society, vol 72, no 2, pp 297–300, 1978 D G Bourgin, “Classes of transformations and...
- 10
- 296
- 0
The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company
... line with the registration - Registering, enumerating and paying taxation as well as performing other financial obligations in accordance with the prevailing laws - Ensuring product quality in ... wise to adopt the internal law as governing law to the contract On the other hand, the parties can agree to adopt a certain world law regarding international trade that can listed here as CISG ... appliances, as well as the domains of real estate and logistics The group is also one of the largest manufacturing and exportation bases of electric appliances in China Major products by Midea Group include...
- 41
- 614
- 0
Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx
... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team -work ... Effectively The SWG is the multi-disciplinary team -work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative ... cycle, the team has evaluated these activities In general, farmers has applied knowledges what they learnt from FFSs and trainings to improve their farming For instance, farmers used IPM as the way...
- 8
- 492
- 0
Tài liệu THE VALUE OF IMPROVED PUBLIC SERVICES: AN APPLICATION OF THE CHOICE EXPERIMENT METHOD TO ESTIMATE THE VALUE OF IMPROVED WASTEWATER TREATMENT INFRASTRUCTURE IN INDIA docx
... Falling Below Zero Quality of Quantity of Regeneration Treated Treated of the Park Wastewater Wastewater Average Average Average Average Average Average vs vs vs vs vs vs profile profile profile ... * Working Paper 49/2009 MNEs and Export Spillovers: An Analysis of Indian Manufacturing Industries Chiara Franco and Subash Sasidharan * Working Paper 50/2010 Reforming Indirect Taxes in India: ... Characteristics of the Tall and Not So Tall Women of India Brinda Viswanathan and Viney Sharma * Working Paper 42/2009 Inter-State Imbalances in Essential Services: Some Perspectives C Bhujanga...
- 40
- 472
- 1
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... PAGE analysis of the mitochondrial membranes isolated from all these deletion strains and from a wild-type strain In the DQCR9, DISP and DBCS1 strains, a protein band of approximately 500 kDa ... Molecular characterization of a 500 kDa bc1 sub-complex in the yeast deletion strains lacking Qcr9p, ISP or Bcs1p BN ⁄ PAGE analysis of a yeast mutant strain in which the gene encoding the Qcr9p ... however, the interaction between the bc1 subunits was hypothesized only indirectly by assaying the steady-state levels of the remaining subunits in the mitochondrial membranes of yeast strains in which...
- 15
- 639
- 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
... levels of identity to sequences of 2-aminomuconate deaminases [6,8,27] or to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the ... enzyme activity In contrast, the deaminase from strain 10d contained an FAD-like cofactor, similar to D-amino acid oxidases [25–27], as indicated by the absorption peak of the purified enzyme at 266 ... metacleavage pathway of 2-aminophenol in Pseudomonas sp strain AP-3 (A) Proposed pathway of 4-amino-3-hydroxybenzoic acid in Bordetella sp strain 10d (10) I, 4-amino-3hydroxybenzoic acid; II, 2-amino-5carboxymuconic...
- 7
- 613
- 1
Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc
... formed The anchoring of a- carboxylate and a- amino group in the external aldimine defines automatically the positions of the a- proton and the side chain of any bound amino acid The lability of the a- proton ... L-methionine the rate of abstraction of the a- proton, leading to formation of the quinonoid intermediate, is less by a factor of 2.5 than for the reaction with L-phenylalanine The observed retardation ... 568, and 754 and treated as above The theoretical values of isotopic exchange rates were calculated, based on the assumption that the number of operative active sites participating in reactions of...
- 7
- 532
- 0
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot
... contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular mass of 87 392 Da The total calculated ... (ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene (gcccagtacctacaagattc) Localization of xdhAB genes on the C acidovorans plasmid was established using the AlkPhos Fig Location of the ... (Fig 5A) , confirming the cross-reactivity with antisera raised against C acidovorans XDH Activity staining with xanthine/Nitro Blue tetrazolium of native gels containing equal levels of activity...
- 11
- 584
- 0
– THE GRE QUANTITATIVE SECTION – The area of a sector is found in a similar way to finding the pptx
... a cylinder, use the formula V = r2h h r S URFACE A REA The surface area of an object measures the combined area of each of its faces The total surface area of a rectangular solid is double the ... (the median), and/or the average of all the values (the mean) M EAN AND M EDIAN To find the average, or the mean, of a set of numbers, add all the numbers together and divide by the quantity of ... Review Many questions on the GRE will test your ability to analyze data Analyzing data can be in the form of statistical analysis (as in using measures of central location), finding probability, and...
- 25
- 410
- 0
Báo cáo sinh học: "Optimal design for the detection of a major gene segregation in crosses" potx
... between Fl and P2) are also heterogeneous AA or AB animals (BC1) and AB or BB animals (BC2) with proportions 1/2, 1/2 The statistical analysis of the data obtained from these populations was clearly ... emphasized These curves are nearly linear for power under 70% and, in this linear part, the slope (ie the gain in power = = = per extra individual measured) increases with a The resulting increase ... give a similar power for a dominant gene, the F2 must be used in the case of an additive gene, with a power varying between 60 and 70% against 30 to 40% for the backcross In the Cl situations the...
- 11
- 368
- 0
Báo cáo y học: "Chronic whiplash and central sensitization; an evaluation of the role of a myofascial trigger points in pain modulation" docx
... tissues, and explained the finding as the expression of an abnormal processing of nociceptive information in the brain and spinal cord [2-7] Others have postulated that chronicposttraumatic myalgia ... central sensitization in patients with shoulder pain of myofascial origin [10] In contrast, Curatolo et al, in a study of chronic whiplash patients, reported that anesthetic infiltration of painful ... study the authors set out to evaluate whether anesthetic infiltration of myofascial trigger points in patients with chronic and refractory neck pain can affect pain thresholds in uninjured parts of...
- 8
- 531
- 1
Bóa cáo y học: "Is the value of a life or life-year saved context specific? Further evidence from a discrete choice experiment" ppt
... saving the life of a year old with a life-expectancy averaging a further 76.3 years in the Australian population [38,39] is then estimated at AUD838,567 Willingness to pay for saving the life of ... obtained by multiplying the value of a life-year saved by the remaining life-expectancy because the marginal effects on incremental effectiveness and incremental cost are calculated for a program ... mortality gains; the magnitude, duration and timing of quality of life gains; the magnitude, duration and timing of non-health benefits including productivity gains [24]; and an almost innumerable...
- 15
- 363
- 0
Báo cáo y học: " The value of a risk model for early-onset candidemia" ppt
... of all bacteremia cases), certain high-risk patients have much higher rates approaching 27% as outlined in this study Risk stratification by application of the validated risk model can have a ... have a profound impact on early therapy and intervention in these cases The role of early appropriate therapy has become important as inappropriate or delayed therapy leads to higher mortality [8-10] ... Molina FJ, BlascoNavalproto MA, López MJ, Charles PE, Martín E, Hernández-Viera MA: Usefulness of the ‘Candida score’ for discriminating between Candida colonization and invasive candidiasis in...
- 2
- 304
- 0
the value of switching and growth options in foreign direct investmentl
... Although the point that there are costs to creating and managing real options is not new, showing that the same factors that increase the value of flexibility also increase the cost of creating ... initial investment and exogenous uncertainty becomes evident or is it the active gathering of information starting from the initial investment? What kinds of learning activities are actually taking ... residuals) in a country, divided through (2004) the mean of the exchange rate level in that year Cuypers& Parallel market premium=|average annual official rate-average Martin (2006) annual parallel...
- 137
- 208
- 0
An application of a discourse-based approach in teaching English skill at Thanh Hoa Vocational School of Commerce – Tourism = Ứng dụng phương pháp tiếp cận dựa
... structures and logical meaning of the material they read with an average degree of difficulty and within general and familiar topics, but cannot understand the rhetorical and functional meaning of sentences, ... social situation British discourse analysis was mainly influenced by M .A. K Halliday‘s functional approach to language Halliday‘s framework emphasized the social function of language and the thematic ... comprehension and the discussions of discourse analysis and the teaching of reading comprehension are presented The application of discourse-based approach in teaching reading is the application of the...
- 66
- 703
- 0
The impact of a genre-based approach on 11th students’ writing performance An action research at Tuyen Quang Gifted High School, Tuyen Quang
... 2 Aims and objectives of the research The research is aimed at investigating students‘ attitudes towards the genre-based approach, which was new to them, and examining whether this teaching approach ... of Language in Social-Semiotic Perspective Geelong: Deakin University press 11 Hamond,J (1987) An overview of Genre-Based Approach to the teaching of Writing in Australia, Australian Review of ... research was conducted and the informants involved in the research It includes the writing tasks in the textbook, research design, the teaching cycle in the study The method of data collection and...
- 5
- 548
- 6
báo cáo hóa học:" The PedsQL™ as a patient-reported outcome in children and adolescents with Attention-Deficit/Hyperactivity Disorder: a population-based study" pdf
... confidentiality of the respondent's answers and the neutrality of the organization gathering the data, all surveys were mailed back to DataStat Since the intent of the SCHIP project was program evaluation and ... herein Statistical analysis The feasibility of the PedsQL™ 4.0 as a population health measure in ADHD was determined from the percentage of missing values for each item [29,38,39] Scale internal ... perceptions of the impact of disease and treatment as clinical trial endpoints, and include multi-item HRQOL instruments, as well as single-item measures (e.g., pain visual analogue scale), daily diaries,...
- 10
- 538
- 0
Báo cáo y học: "Evaluating the potential of a novel oral lesion exudate collection method coupled with mass spectrometry-based proteomics for oral cancer biomarker discovery" docx
... display option called “Quantitative value in Scaffold v 3.0, is used to determine relative abundance of proteins within datasets Normalized Spectral Counting and statistical analysis of quantitative ... counting as a means to assess the relative abundance of selected high abundance saliva proteins within each sample As shown in Figure 2b, all of the selected salivary proteins were present in significantly ... experiments, analyzed and interpreted data, wrote the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests...
- 11
- 350
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose