the passionate programmer creating a remarkable career in software development

Báo cáo khoa học: Neural retina leucine-zipper regulates the expression of Ppp2r5c, the regulatory subunit of protein phosphatase 2A, in photoreceptor development pdf

... 5Â-GTA GAC AGAGAC CAA GGC TGC-3Â; Ppp2r5c, forward, 5Â-CCC TCTAAG AGC TGG GAT TCT-3Â; Ppp2r5c, reverse, 5Â-CAAACT GAA GCT CTC TGC AGC-3Â).Statistical analysisStatistical analysis of variances ... AT-3Â; oli-gonucleotides for the Ppp2r5c promoter, 5Â-CCC TGAAGC CAG GAT GAG CCG CAG GGA AAG-3Â and5Â-TGG AGC TC G CTG ATT GGC CAG AAG CTG CAA-3Â) was used for the following EMSA assay. The ... E15 and P14 mouse retinalRNA was extracted, and quantitativereal-time PCR analysis was performed usingprimers speciﬁc for rhodopsin, Ppp2r5c andGapdh. The Gapdh gene was used as aninternal...

Tài liệu The Five Most Dangerous Issues Facing Sales Directors Today, and How to Guarantee a Permanent Improvement in Sales Results pdf

Danh mục: Tiếp thị - Bán hàng

... Limitedwho has dedicated the last 13 years to the development ofsales managers andsalespeople formany largeinternationalorganizations. Research FindingsâTRAINIQUE LTD AND THINK TRAINING INC. ... resources, and kits thatsave managers’ time and enhance the impact of their coaching time. ©TRAINIQUE LTD AND THINK TRAINING INC. 2004 18● HARDER RATHER THAN SMARTER In the book Emerson’s Essays, there ... if they get an initial two weeks oftraining. Have companies discovered that training doesn’t really pay off? On the contrary!Training appears to be even more important today than years ago, and...

The Art Of Creating A Successful Blog – Tips From The Pros

Danh mục: Internet Marketing

... Joshua whether that was actually limiting at all in any way, since there weren’t the library of ready-made tools available to “add-on” to the base platf orm.Joshua didn’t hesitate to point out ... – in f act one of the leading web-design blogs on the Internet – SmashingMagazine. The rise of Smashing Magazine wasn’t quite as f ast as The Verge. It was f ounded in 2006 by Sven Lennartzand ... ScratchI started the interview asking Vitaly about the f irst year that he and Sven f ounded Smashing Magazine,and what their hopes and dreams were f or the site. and what their hopes and...

Tài liệu The Passionate Programmer doc

Danh mục: Kỹ thuật lập trình

... become famous. But pleasedon’t forget that these are not the goals. They’re a means to an end.Failure Is Off the Radar!One of the major steps along the road to creating a remarkable career for ... looking at the state of the industry at that time, as Sunwas, you may have seen something special in Java. You may have had a strong feeling that it was going to be big. Investing in it early ... whenyou’ve made mistakes. This book lays out a strategy for planning and creating a radically successful career (and, therefore, life) in software development. The book is also about cultivating the...

218
1,396
3

Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization ﬁeld pptx

Danh mục: Báo cáo khoa học

... estimated by the Whiteman Alcian blue binding technique [28,29], usingchondroitin sulfate as standard. The assay was adapted to the estimation of GAG in more dilute samples by increasing the aliquot ... 32472–32481.69. Samata, T., Hayashi, N., Kono, M., Hasegawa, K., Horita, C. &Akera, S. (1999) A new matrix protein family related to the nacreous layer formation of Pinctada fucata. FEBS Lett. ... Fourier transforminfrared spectroscopy (FTIR) and X-ray diﬀraction analyses ofmineral and organic matrix during heating of mother of pearl(nacre) from the shell of the mollusc Pinctada maxima. J....

Báo cáo "The linguitic Situation of a Hmong Community in the North - West of Vietnam " pdf

Danh mục: Báo cáo khoa học

...

The cinema-cognition dialogue: a match made in brain docx

Danh mục: Sân khấu điện ảnh

... SYSTEMS IN THE BRAINUnderstanding how the human brain reads a movie and reactsto it can beneﬁt from understanding how the brain acquiresinformation about the world in gener al. Our brain has evolvedmultiple ... unparalleled and highly rewarding experimentation space for the mind of the individual consumer of that art. In parallel, it also provides a useful and promising devicefor investigating brain and ... WeizmannInstitute of Science, Rehovot 76100,Israel.e-mail: yadin.dudai@weizmann.ac.ilThat human evolution amalgamates biological and cultural change is taken as a given,and that the interaction...

Báo cáo hóa học: " Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" pdf

Danh mục: Hóa học - Dầu khí

... 1960(1851)TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGGcanus fam EcoRI BamHI (1809)TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGGpK9 ... ChickenGCATGTGCGGGCAGGAAGGTAGGGGAAGAC XenopusTATTGTACCTGGAGATATATGCTGACACGC RatTATTGGACCTGGAGATAGGTACTGACACGC MouseTTTGGGCCGCCGGGTTATATGCTGACACGC HumanTTTTTTGTTGCCAGGTAGGTGCTGACACGT MDCKDetermination ... occurs in the MDCK pol I containing fragment.pAD4000(3100 bp)bla a IISV40pICaninepIICMVoritICGACCT CCGAAGTT GGGGGGGAG AGT CTT CT CGA GT AGAAG ACC GA CCT ACCT GGCAACAAAAAAT GTGCTGGAGGCTT...

Báo cáo hóa học: " The happiness of people with a mental disorder in modern society" pdf

Danh mục: Hóa học - Dầu khí

... Gureje, O,Haro, JM, Kawakami, N, Karam, A, Levinson, D, Medina Mora, ME, Oakley Brown, MA, Posada-Villa, J, Stein, DJ, AdleyTsang, CH, Aguilar-Gaxiola, S, Alonso, J, Lee, S, Heeringa, S, Pennell, ... sexual abstinence. The better the external living condi-tions in society, the more the remaining differences in happiness depend on inner lifeability. As a result, the negative effects of mental ... 2005. Layard is an emerit us profes sor in economics and a Downing Stre et advisor in the UK. He was trying to persuade the government to train an army of psychotherapists. In his influential book...

the monk and the riddle the art of creating a life while making a living randy komisar

Danh mục: Kỹ năng làm việc nhóm

... the plan. He was a savvy investor, but he was not acquainted with technology startups and wasincreasingly rattled by the risk inherent in this venture.Finally, after yet another hand-wringing ... me, a pillar of the local bar association. At the end of the hearing, my boss, the lead partner in the case, turned to me shaking his head. “You're a lawyer's worst nightmare. A guyworks ... that theywere unsustainable. But people I greatly respect were certain that I was being alarmist.I wrote the book anyway.I focused on a critical weak link in the chain: the human side, the...

Báo cáo lâm nghiệp: "Results of a phenological study of the tree layer of a mixed stand in the region of the Drahanská vrchovina Upland" ppt

Danh mục: Báo cáo khoa học

... Phenological data are a certain expression of the climate character of a given region. us, they can contribute to assess the variability of weather and also to evaluate the impacts of potential ... are carried out three times a week. In the summer and autumn season, the observations are carried out once a week. e ordinal number of a day from the beginning of the calendar year was assigned ... from the assessed stand, the amount of precipitation, air temperature and radiation were monitored in the open area.To evaluate phenological data for the characterized period, arithmetic mean,...

Báo cáo toán học: "Developing new locality results for the Pr¨fer Code u using a remarkable linear-time decoding algorithm" pdf

Danh mục: Báo cáo khoa học

... 1, and so the decoding algorithm has indeed reversed the encoding algorithm.As noted earlier, the traditional decoding algorithm creates the edges of the tree in the same order as the encoding ... sorting routines. For instance, in the linear-time algorithms given byCaminiti et al. [1], one must extract certain structural information from the Prăufer stringor tree, and then invoke an integer-sorting ... presented earlier in the paper contain any additional patterns of interest. The framework developed in this papercould also be used to investigate the locality of other tree representations in greater...

Báo cáo toán học: "The maximum size of a partial spread in H(4n + 1, q 2) is q 2n+1 + 1" docx

Danh mục: Báo cáo khoa học

... spreads cannot exist, which has made the question on the size of a partial spread in such a space, an intriguing question. A partialspread is said to be maximal if it cannot be extended to a larger ... relation on generators, and then use inequalities involving eigenvaluesto obtain an upper bound. In general, the calculation of eigenvalues for this relation onm-spaces in a polar space is much ... purposes these calculationsare considerably shorter a s the oppositeness relation can be directly a ssociated with the dual polar graph. The dual polar graph is distance-regular and hence we readily...

Báo cáo toán học: "Differential display identifies overexpression of the USP36 gene, encoding a deubiquitinating enzyme, in ovarian cancer" pot

Danh mục: Báo cáo khoa học

... ggatccatttaggtgacactatagaagtacctgaaaggaagcttttttttttcgaggatttcctgtatttattaagttacaagttggcaggcacagcttgagcaacatagaaaagtaatcttcttgagttatacaatcatttaaattccaaagcactcacaaaattgagcaaacaaagccactatttgcatatttgggaaaggaaacatattgctaacgtaagcttcctgaatccttcatggcctatagtgagtcgtattagaattc-3’). The synthesized riboprobe was precipitated by ... measured by liquid scintillation analysis. The probe for USP36 is 130bp (5’- ttacaagttggcaggcacagcttgagcaacatagaaaagt aatcttcttgagttatacaatcatttaaattccaaagcactcacaaaattgagcaaacaaagccactatttgcatatttgggaaaggaaa-3’). ... The generated antisense probe for USP36 is 267bp (5’- ggatccatttaggtgacactatagaagtacctgaaaggaagcttttttttttcgaggatttcctgtatttattaagttacaagttggcaggcacagcttgagcaacatagaaaagtaatcttcttgagttatacaatcatttaaattccaaagcactcacaaaattgagcaaacaaagccactatttgcatatttgggaaaggaaacatattgctaacgtaagcttcctgaatccttcatggcctatagtgagtcgtattagaattc-3’)....