the mutations of the pig a gene as a common genetic basis for pnh and aa pnh syndrome
Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf
... less active than the mature peptide [14] To help determine the structural basis of the inhibition of the antimicrobial activity of CbnB2 by the leader and to assist future analysis of the interaction ... argon for h The oxidation was quenched by addition of aqueous ascorbic acid (1 M), and the crude product was purified by RP-HPLC The fraction showing the correct mass spectrum (mass 6990.8) was ... were obtained from analysis of the diagonal-peak to crosspeak intensity ratio in the HNHA experiment, with torsion angles calculated from the Karplus equation [34] and assigned a variance of ± 15°...
- 9
- 519
- 0
The Handbook of Project Management: A Practical Guide to Effective Policies and Procedures, 2nd Revised Edition_1 doc
... CHANGE AND THE PROGRAMME AND PROJECT MANAGER Programmes and projects are concerned with creating and managing change in an organized and structured manner Proven tools and techniques are available ... understand This does not mean they are always easy to apply, because of the complexity of the work and the effects of scale The emphasis is on business programmes and projects, which are often small ... stages and tasks where required WHAT IS A PROGRAMME? All organizations today recognize that they operate in an environment of change and must quickly react to forces that affect performance and...
- 24
- 657
- 0
The Handbook of Project Management: A Practical Guide to Effective Policies and Procedures, 2nd Revised Edition_2 doc
... but are still important for the organization and are always part of strategy After all, failure to comply may lead to legal and commercial difficulties or financial penalties Change: programmes ... to have a three- or five-year corporate plan and a shorter oneyear strategic plan The corporate plan will set the future direction of the organization and establish broad targets The strategic ... territory of the management It is the people who the day-to-day operational work who often have the best ideas for improving organizational performance, both in current operations and in terms of creating...
- 24
- 654
- 0
The Handbook of Project Management: A Practical Guide to Effective Policies and Procedures, 2nd Revised Edition_3 pptx
... current and forecast customer base; changes to market forecasts; current (and previous) forecast completion dates; reasons for changes to forecasts; exceptions to plans; changes to customer and other ... investigation – the idea has passed through Gate Zero It’s a good idea, so the PST approves the assembly of a small skilled team to investigate the idea in more detail Assign to a ‘WAIT LIST’ for ... systems for the mapping of resources throughout the organization are now available and provide fairly accurate up-to-date information about all the commitments made on all active programmes and projects...
- 24
- 629
- 0
The Handbook of Project Management: A Practical Guide to Effective Policies and Procedures, 2nd Revised Edition_5 ppt
... identify the sponsor Planned start date for the project The planned start date is the date when the real work of definition started after PST approval of Phase Gate One This may not be the day of approval, ... internal, there may be another party in the supply chain such as an end client with users All these people have an interest, which means they have an agenda of their own for the project Although the ... the stakeholders as stated in the agreed business case, project brief or agreed definition A risk that becomes a reality is treated as an issue A risk always has a cause and, if it occurs, a consequence...
- 24
- 511
- 0
The Handbook of Project Management: A Practical Guide to Effective Policies and Procedures, 2nd Revised Edition_6 pptx
... AB1 AC1 AD1 AA2 AB2 AC2 AD2 AA3 AB3 AC3 AD3 AA4 AB4 AC4 AD4 AA5 AB5 AC5 Key Stage or First level AD5 etc etc AB5/1 etc AB5/2 Second level Third level AB5/3 AB5/4 Lower levels as required AB5/5 ... requesting approval of the project definition and authority to pass Phase Gate Two Do not allow your team to assume that approval is a foregone conclusion and start work on the planning phase This ... graphic impact of the diagram developing makes each member of the team question and debate the validity of the logic as it grows An example of a logic diagram is shown in Figure 7.1 Note that the logic...
- 24
- 488
- 0
The Handbook of Project Management: A Practical Guide to Effective Policies and Procedures, 2nd Revised Edition_7 pptx
... It is a reasonable way to start but always take a cautious approach Elegant technical tools such as Monte Carlo exist for estimating but they depend on a large database of information and are difficult ... but also the most accurate form of estimating The data for all the tasks can be rolled up for each key stage using the work breakdown structure, allowing the preparation of the key stage cost data ... the planning phase Now the duration and effort for all the tasks in every key stage are analysed in detail to derive accurate estimates for the schedule preparation 140 l The programme and project...
- 24
- 553
- 0
The Handbook of Project Management: A Practical Guide to Effective Policies and Procedures, 2nd Revised Edition_8 pptx
... this has been calculated; the name of the person responsible for carrying out the task; the planned START and END dates for each task; a record of the actual START and END dates for each task Once ... stage schedule START and END dates, whether the key stage is critical and the calculated float; the duration of each task in the key stage using consistent units; the amount of float in each task ... PLANNED START AND END DATES FOR EVERY TASK IN THE KEY STAGE ENSURE THE END DATE OF THE FINAL TASK IS NO LATER THAN THE END DATE FOR THE KEY STAGE AGE 22 23 AS WORK PROGRESSES RECORD ACTUAL START...
- 24
- 493
- 0
The Handbook of Project Management: A Practical Guide to Effective Policies and Procedures, 2nd Revised Edition_10 doc
... have close and detailed information about each team member’s performance and this needs to pass back to their line manager as part of the more formalized performance appraisal process You can ... You can use the WBS and the key stage Gantt chart as the basis for collecting these data Cost performance A graph showing cost planned and actual cost may seem to be a simple solution An example ... • the accuracy of the detailed planning of the tasks to be done; the complexity of the work; the amount of interruptions to the work; the availability of data and equipment; how the individual...
- 24
- 576
- 0
The Handbook of Project Management: A Practical Guide to Effective Policies and Procedures, 2nd Revised Edition_12 pptx
... easy always to One of the most valuable features of all project management software is the speed and ease of reporting a large amount of information in excellent formats This makes a significant ... programs are really a combination of graphics, spreadsheet and database programs to make a complex operating system for managing all aspects of the project The graphics part produces the Gantt chart, ... chart, the logic diagram or PERT chart and the graphs used for reporting The spreadsheet part is used for the forms, tables and reports produced using the available data The database part stores and...
- 24
- 404
- 0
The Handbook of Project Management: A Practical Guide to Effective Policies and Procedures, 2nd Revised Edition_13 doc
... their associated activities arranged in a hierarchical format, showing each level of planning Work plan A standard format form or chart for recording an agreed listing of the tasks to be carried ... probability and management Appendix l 287 Risk management form A standard template recording risk data and the proposed actions to take when the risk occurs so as to minimize the damage to the ... cent The cost variance divided by the value of the work actually performed (BCWP) Critical activity Any activity in the project that has been analysed to show it has zero float and must therefore...
- 15
- 424
- 0
báo cáo khoa học: "Persistence of TEL-AML1 fusion gene as minimal residual disease has no additive prognostic value in CD 10 positive B-acute lymphoblastic leukemia: a FISH study" doc
... TEL-AML1 fusion as a minimal residual disease TEL-AML1 fusion as a minimal residual disease Kaplan-Meier curve for the persistence of TEL-AML1 fusion as a minimal residual disease (MRD) as a predictor ... NMK participated in study concept and was responsible for the clinical aspect of the work as regards patients' clinical assessment, management and follow-up All authors read and approved the manuscript ... (CR) was defined as the complete disappearance of all tumor masses confirmed at clinical examination, or X-rays, and ultrasound studies; a normal BM examination and pathology; and no evidence of...
- 7
- 225
- 0
báo cáo khoa học: " Characterization of cp3 reveals a new bri1 allele, bri1-120, and the importance of the LRR domain of BRI1 mediating BR signaling" doc
... sequences of the primers used were a 5-cgttagatctcagcttcaacaatttctccgg-3’ (forward) and 5’-ccggagaaattgttgaagctgagatctaacg-3’ (reverse) All of the resulting plasmids were fully sequenced to confirm the ... all of the bri1 mutant alleles are dispersed in both an extracellular domain and a cytoplasmic kinase domain [4,16] The extracellular domain of BRI1 consists of LRRs and a 70-amino acid island ... the same aliquot of first-strand cDNA as a template Polymerase chain reaction was as followings: pre-denaturation at 94°C for min., denaturation at 94°C for 30sec., primer-annealing at 52°C for...
- 11
- 389
- 0
báo cáo khoa học: " Characterisation of the legume SERK-NIK gene superfamily including splice variants: Implications for development and defence" ppt
... TCAGTGCATCACCTTCAACATTAG-3’; MtSERK3 - forward primer 5’- GTGTATCGTGTTTAC GAGAACGTAATGG-3’, reverse primer 5-TCACGGTGAATAATCTTAGGGTCACA-3; MtSERK4 - forward primer 5’- CAATGAAGAAAGTGATGCCCTGAA-3’, ... 5’-TCCAATCTGGTATG GT CTGT-3’ MtSERK4 was amplified in two overlapping PCR reactions using the primers - forward primer 5’-GCAAAGAAAACAAACAAAAGCCATAC-3’ with reverse primer 5’-CTGGTGACGGTGGAGAAAGTG-3’ ... CATCATTGCATCCAACATGA AACC-3’; MtSERK5 - forward primer 5’- CTTCTT CCAATGATGAAAGTGATGC-3’, reverse primer 5’-AT CAACCCGGATTACTCTACCACCAC-3’ and MtSERK6 forward primer 5’- CATCACCAGCTTCTTCAGG TAGCA-3’,...
- 16
- 486
- 0
Đề tài " A five element basis for the uncountable linear orders " doc
... In particular if X is a set of reals of cardinality ℵ1 , then X serves as a single-element basis for the class of uncountable separable linear orders PFA is a strengthening of the Baire Category ... is relatively consistent with the usual axioms of mathematics (ZFC) together with a strong form of the axiom of infinity (the existence of a supercompact cardinal) that the class of uncountable ... + MAℵ1 ) There are no A, B, and Y which satisfy the conclusion of Lemma 5.24 In particular, ∂(K) is canonically proper Proof We will assume that there are such A, B, and Y and derive a contradiction...
- 21
- 410
- 0
Báo cáo khoa học: Sherlock Holmes and the proteome ) a detective story Pier Giorgio Righetti1 and Egisto Boschetti2 potx
... major advantages as well as the limitations of the present approach The advantages are at least twofold: while this highly diversified ligand library is able to greatly concentrate rare and very rare ... each bead has many copies of a single, unique ligand, and each bead has a different ligand from every other bead Considering that, for the synthesis of a protein, many amino acids are used, the ... kDa) can be seen at a glance In the search for novel biomarkers, Equalizer Beads have also been applied to plasma and sera by Lathrop et al [28] Analysis of cells and tissues Although biological...
- 9
- 666
- 0
Báo cáo khoa học: "Mutations of p53 Tumor Suppressor Gene in Spontaneous Canine Mammary Tumors" doc
... Australian Terrier and Shih Tzu) To identify distant metastases, thoracic radiographs and ultrasonographs of the liver, kidney and spleen were obtained before surgery Each case was classified according ... tumor Adenoma Adenocarcinoma Papillary adenocarcinoma Adenocarcnioma Malignant mixed tumor Adenocarcnioma] Malignant mixed tumor Adenocarcnioma Malignant mixed tumor Malignant mixed tumor Malignant ... Setoguchi A. , Sakai T., Okuda M., Minehata K., Yazaw a M., Ishizaka T., Watari T., Nishimura R., Sasaki N., Hasegaw a A and Tsujimoto H Aberrations of the p53 tumor suppressor gene in various tumors...
- 5
- 184
- 0
A study on the side spray fluidized bed processor with swirling airflow for granulation and drug layering
... material across the spray zone and the gap air assists with material flow The centrifugal force contributed by the rotating frictional disk, the uplifting force from gap air and the gravitational force ... choice of operational parameters of the process C.1 Effect of raw materials on granulation and coating The effect of raw materials on granulation and coating have been studied extensively Some of the ... exposed to the atomized coating formulation in the spray zone again The motion of the core particles was reported as one of the important factors in governing the appearance of the coated product...
- 181
- 448
- 0
The quality of financial assessment in the lending activity of Viet Nam commercial banks (Vietnam Joint Stock Commercial Bank for Industry and Trade)
... Thedemographic characteristics and information about the number of officers, during an assessment of the project are summarized in the above table 15 16 As a result, the factor analysis for the ... commercial bank for industry and trade information, the operation of the evaluation, the process and the evaluation method 2.1.1 The general view about the history and the framework structure of vietnam ... mobilized activities and arrange the source of capital in a positive method, vietinbank remained the stability and sustainable 2.2.3 The real situation of the quality of the financial evaluation...
- 12
- 550
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25