the function myaverage accepts the parameters a b c and d

macromedia flash mx advanced for windows and macintosh

... Music4Flash.com, RocketClips.com, Kim Steinhaug and SubReal from Flashkit.com, 3DModelz.com, 3DM-MC.com, Help 3D. com, and Eden, Jonah, Bennet, David, Alexandra, and Christina Chun and their proud ... trademark, and Macromedia Flash and Flash are trademarks of Macromedia, Inc Throughout this book trademarked names are used Rather than put a trademark symbol in every occurrence of a trademarked name, ... Harrington, SadSadFun (A Gass, B Chulada, F Parsa, and M Chulada), Derek Jimenez, and Tim Cramer Additional images and sound provided courtesy of Benjamin Cummings, Corel Photo, Gary Fisher bikes,...

819
4,244
0

This questionnaire is designed to investigate teachers’ attitude towards the applicability of process approach in teaching writi

Danh mục: Khoa học xã hội

... presentation of a model text which is analyzed and the basis of a task that leads to the writing of an exactly similar text And according to Robinson (1991), product approach can be summarized in the following ... teaching in comparison with the product approach A teacher who adopts the approach will try to respect the learners’ cultural background and avoid the imposition of ideas or language behavior The ... lessons Contrary to our expectation, some tasks that receive most support from the teachers such as writing about advantages and disadvantages of the mass media and describing chart/table turn...

Tài liệu In this lab, 2 ISDN routers are required. If ISDN routers are not available, review the lab to become familiar with the process. An Adtran Atlas550 ISDN emulator is used to simulate the switch/ISDN cloud. pdf

Danh mục: Hệ điều hành

... Please refer to the chart at the end of the lab to correctly identify the interface identifiers to be used based on the equipment in the lab The configuration output used in this lab is produced ... Sydney(config-if)#dialer string 5551001 Step Associate dialer profiles a Finally, associate the Dialer Profiles with the Dialer Interfaces that will be used, when needed Create a Dialer Pool, and ... Traffic must be defined as ‘interesting’ to cause the DDR interface to dialup the remote router For the moment, declare that all IP traffic is interesting using the dialer-list command Moscow(config)#dialer-list...

Tài liệu Báo cáo khoa học: The PA-TM-RING protein RING ﬁnger protein 13 is an endosomal integral membrane E3 ubiquitin ligase whose RING ﬁnger domain is released to the cytoplasm by proteolysis ppt

Danh mục: Báo cáo khoa học

... oligonucleotides and probes used are given in Table S2 Probes were synthesized with a 5¢-FAM dye These oligonucleotides and probes were designed and synthesized by the UNC-CH Animal Clinical Chemistry and ... (Rockford, IL, USA) Fluorsave was from Calbiochem/EMD Chemicals (Gibbstown, NJ, USA) Puriﬁed ubiquitin was a gift from J McCarville (UNC-CH) Rabbit E1 enzyme and human UbcH 5a, UbcH 5c and UbcH6 E2 enzymes ... (Fig 4B, lane 4) Both the heterogeneous bands at 80 kDa and the group of bands at 65 kDa were recognized by the anti-HA serum (Fig 4B, lanes and 5) As these proteins are also recognized by the...

Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspeciﬁc alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

Danh mục: Báo cáo khoa học

... phosphatase activity (ordinate, unit per mL fraction) BSA (b, 68 kDa), alcohol dehydrogenase (a, 141 kDa) and catalase (250 kDa) were loaded on to a separate gradient as molecular mass markers alkaline ... (ordinate, unit per mL fraction) BSA (b, 68 kDa), alcohol dehydrogenase (a, 141 kDa) and catalase (c, 250 kDa) were loaded on to a separate gradient as molecular mass markers Not only the aggregate ... elastatinal, leupeptin, pepstatin A) was added to cell lysates and media (10 lgÆmL)1 for each) Unless stated otherwise, iodoacetoamide was not added to the lysates and media The lysates were incubated...

The nobel prize in physiology or medicine 2010 is awarded to

Danh mục: Cao đẳng - Đại học

... Medicine, Secretary of the Nobel Assembly; Outi Hovatta, Obstetrics and Gynaecology; Christer Höög, Genetics; Klas Kärre, Immunology, Chairman of the Nobel Committee; Hugo Lagercrantz, Paediatrics; ... Clinic, Robert Edwards giáo sư danh d Đại h c Cambridge Ban biên tập năm giới thiệu phổ biến giải Nobel Sinh lý Y khoa bao gồm c vấn khoa h c sau đây, tất giáo sư Viện Karolinska: Göran K Hansson, ... này, R.E lại Cambridge nơi làm vi c Patrick b nh viện Oldham, gần 300km Sau hang trăm lần thất b i c gắng để làm diễn mang b u, họ định b qua phần điều trị hormone nhắm tới kích thích buồng trứng...

Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx

Danh mục: Báo cáo khoa học

... |Fobs ) Fcalc|)/( |Fobs|), where Fobs and Fcalc are observed and calculated structure factor amplitudes, respectively Rfree is an R-factor for an unreﬁned subset of the data (5% of the data) a the ... JT Baker (Phillipsburg, NJ); NH4Cl, NaCl and MgSO4, Sigma-Aldrich; and amino acids, Merck ⁄ Calbiochem (Darmstad, Germany) ˚ The labeled SaSTP crystal diffracted to 2.50 A resolution We collected ... present in the S agalactiae PPase, kinase and adenylosuccinate synthase, but not in S agalactiae CovR ⁄ CsrR The motif is located at the surface of the SaPPase (Rantanen, unpublished), and superposition...

$Báo cáo khoa học: Cellular refractoriness to the heat-stable enterotoxin peptide is associated with alterations in levels of the differentially glycosylated forms of guanylyl cyclase C pdf$

Báo cáo khoa học: Cellular refractoriness to the heat-stable enterotoxin peptide is associated with alterations in levels of the differentially glycosylated forms of guanylyl cyclase C pdf

Danh mục: Báo cáo khoa học

... per cent of the internalized receptor is recycled back to the surface and the rest is directed to the degradation pathway GC -B and NPR -C, the clearance receptor for atrial natriuretic factor, also ... Western blot analysis as described above Surface biotinylation of Caco2 cells Cells were washed with NaCl/Pi (pH 8.0) containing mM CaCl2 and 0.5 mM MgCl2 (NaCl/Pi-CM), and then incubated in NaCl/Pi-CM ... temperature and NP-40 was added to a ﬁnal concentration of 0.75% N-Glycosidase F (200 mU; Roche, Germany) was added and the reaction incubated at 37 C for h After incubation, the reaction was stopped...

Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc

Danh mục: Báo cáo khoa học

... 120 kDa tryptic and chymotryptic reaction products is indicated by an X The amino acid sequences and the modiﬁcation sites are indicated Loop-linked peptides are labeled (T1) ND, not determined ... mode An external calibration was performed using standard peptide solution Cal Mix1 and Cal Mix2 (Applied Biosystems) and an additional internal calibration was performed during mass spectra analysis ... lm) using the double-charged monomer, and the single-charged monomer and dimer Calibration was checked using noncross-linked Ure2p and Ssa1p The mass accuracy was 100–200 Da at 150 kDa One volume...

Economic Effects of Reducing the Fiscal Restraint That Is Scheduled to Occur in 2013 docx

Danh mục: Tài chính doanh nghiệp

... in fiscal policy is sharper when measured on a calendar year basis because most of the policy changes are scheduled to take effect at the beginning of calendar year The Affordable Care Act comprises ... represented by a demand multiplier, defined as the total change in GDP per dollar of direct effect on demand Because there is considerable uncertainty about the economic relationships underlying indirect ... comprises the Patient Protection and Affordable Care Act (P.L 111-148) and the health care provisions of the Health Care and Education Reconciliation Act of 2010 (P.L 111-152) CBO ECONOMIC EFFECTS...

Báo cáo khoa học: MPP3 is recruited to the MPP5 protein scaffold at the retinal outer limiting membrane ppt

Danh mục: Báo cáo khoa học

... human MPP3 by annealing the following primers: 5¢-GACT ACAAAGACCATGACGGTGATTATAAAGATCATGAC ATCGATTACAAGGATGACGATGACAAGCTCATG-3¢ (sense), and 5¢- GTACAGCTTGTCATCGTCATCCTTG TAATCGATGTCATGATCTTTATAATCACCGTCATGG ... Human retina Marathon Ready cDNA (Clontech laboratories, Woerden, the Netherlands) was used to amplify MPP3 Primer pair 5¢-GATCCCGGGCCAGCATGCC AGTGCTATCGGAGG-3¢ (sense) and 5¢-GATCGTCGAC TTACCTGACCCAACTAACAGG-3¢ ... post-translational modiﬁcation MPP3DGuK is detected as a band of 35 kDa (note the breakdown products visible below the 35 kDa band) In the control cells an unspeci c band of 73 kDa can be detected upon...

how the use of the diary form narrative is beneficial to the

Danh mục: Kỹ năng viết tiếng Anh

... combination of descriptions, facts, that represents a group as a whole and the reader can feel as if they are part of the group and read, and think along with the characters Another thing dealing ... the reader "see" exactly how a person was talking and acting through the written dialects In the novel Dracula, all the diaries, of all the individuals come together and in the end, become one ... take place When, there are different people of different places, they can be identified by how they act and how they talk If, Bram Stoker did not use the diary form narrative, this would not be...

Báo cáo khoa học: Proteolysis of the tumour suppressor hDlg in response to osmotic stress is mediated by caspases and independent of phosphorylation pot

Danh mục: Báo cáo khoa học

... and establish cell– cell contact, and that its degradation occurs in all cell compartments in which hDlg is present In addition, in CaCo-2 cells, derived from human colonic adenocarcinoma and ... hDlg D7 4 7A 10 Control Sorbitol Fig Quantiﬁcation of cells attached and apoptotic cells after sorbitol treatment (A) Cell attachment and (B) caspase activation were measured as indicated in Materials and ... caspase and caspase activities were signiﬁcantly induced Other protease activities, including caspase 8, calpain or cathepsin B, were not affected Activation of the effector caspase and caspase suggests...

Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx

Danh mục: Báo cáo khoa học

... in crude membrane fractions with anti-PCaP1 Lanes and 6, A thaliana; lanes and 7, Raphanus sativus; lanes and 8, Brassica rapa; lanes and 9, B rapa var glabra; lanes and 10, B oleracea var italica ... pET ⁄ PCaP1, was then directly ampliﬁed by PCR with a pair of primers (forward, 5¢-CACCACCACCACCAGATGGGTTACTGGAATTCCA AG-3¢; reverse, 5¢-GTGGTGTTTCATATGTATATCTCCT TCTTAAAGTTAAAC-3¢; italic type ... italica The amount of protein applied was lg for A thaliana and 40 lg for the other plants 43 kDa) and Brassica oleracea var italica (broccoli, 41 kDa) (Fig 1B) The immunostained bands disappeared...

Báo cáo khoa học: The activation of gelsolin by low pH The calcium latch is sensitive to calcium but not pH docx

Danh mục: Báo cáo khoa học

... iso-forms [rabbit alpha skeletal, bovine alpha cardiac, bovine aortic and scallop (Pecten) muscles], and established conditions under which the ELISA assay faithfully reflected actin binding The binding ... G-actin by ELISA and fluorescence G-actin was coated onto plastic and increasing concentrations of G4–6 (between and 0.6 lM) were added Binding was monitored by using speci c G4–6 directed antibodies ... G4–6-actin structure and G4–6 in calcium alone The large difference in affinity for actin binding by pHactivated (Kd mM) and calcium-activated (Kd 30–40 nM) gelsolin is probably due to the type I calcium...

She is going to go on business at the end of June potx

Danh mục: Kỹ năng viết tiếng Anh

... c u: (C c b n kích chuột lần vào từ để biết thêm chi tiết từ đó) She is going to go on business at the end of June 2 C c b n di chuột vào c m từ để biết ch c cụm c u: She is going to go on business ... vi c Ví d “In the end we went to school on foot because our bicycle broke down” (Cuối tới trường xe đạp b hỏng) > D ch c u ngh a: C c ng t c vào cuối tháng Sáu B i h c liên quan: Nếu không ... at the end of the book (cuối sách) Mạo từ the đứng trư c từ b t đầu nguyên âm a, e, i, o, u”, the phát âm /ði/ - Trái ngh a với “at the end” “at the beginning” – b t đầu Ví d “at the beginning...

Báo cáo sinh học: "Bisphosphonate-associated osteonecrosis of the jaw is linked to suppressed TGFb1-signaling and increased Galectin-3 expression: A histological study on biopsies" pot

Danh mục: Hóa học - Dầu khí

... initiated and conducted the study, formulated the hypothesis, established and conducted the methods and analytic procedures, and wrote the manuscript PH formulated the hypothesis and interpreted the ... The American Society for Bone and Mineral Research has formed a BRONJ-task force that requires clinical and basic research in jaw-specific biology [17] This study aimed to compare the cellular ... intracellular actions through Smad protein signaling Smad 2/3 was identified as the downstream TGFb1 effector, and Smad inhibited intracellular TGFb1-related signaling [8] Increased TGFb1 and Smad-2/3...

Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

Danh mục: Điện - Điện tử

... (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of recTULV S RNA, RT-PCR was performed with primers RECF738 (5'GCCAGAGAAGATTGAGGCATTTC3'; ... Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed ... transfection-mediated HRec yields functionally competent and stable virus, recTULV The purified and pre-passaged recombinant virus, however, presented no real match to the original cell adapted...

Báo cáo hóa học: " Vaccinia virus lacking the deoxyuridine triphosphatase gene (F2L) replicates well in vitro and in vivo, but is hypersensitive to the antiviral drug " pot

Danh mục: Hóa học - Dầu khí

... IDT 717 (GCGCTCGAGAGGGTTTGGATCAACAGGAC, XhoI site underlined) against F2L residues 417–436 and IDT 718 (CATACATCGTCTACCCAATTCGG) against F1L HindIII-digested, dephosphorylated IDT 715+716 PCR ... significant since intracellular pools of dUMP and dTMP are predicted to be reduced in the absence of the viral dUTPase Thus, the increased ratios of N-MCTMP:dTMP and N-MCT-MP:dUMP should reduce competition ... Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived...

Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf

Danh mục: Hóa học - Dầu khí

... individual mice Mice were mock-infected or infected as indicated below the plots on days and 28 The animals were sacrificed days later (day 36) and lungs and spleens were collected PMC and splenocytes ... isothiocyanate-conjugated anti-mouse CD8 monoclonal antibody, fixed and permeabilized with Cytofix/ Cytoperm (BD Biosciences), and stained with allophycocyanin-conjugated rat anti-mouse IFN-γ antibody, ... influenza virus, as indicated Viral doses are as described in footnote a PMC or splenocytes were isolated on days 42 and 62 (8 and 28 days following the secondary infection), and analyzed as above...

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu