the benefits of a hierarchical structure
The Design and Implementation of a Log-Structured File System
... view the log as the most up to date ‘‘truth’’ about the state of the data on disk. The main difference is thatdatabase systems do not use the log as the final repositoryfor data: a separate data ... area is reserved for this purpose. The separate data area of these database systems meansthat they do not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space. The space ... home of the data. Rather thanredoing the operation to the separate data copy, Sprite LFSrecovery insures that the indexes point at the newest copy of the data in the log.Collecting data in the...
- 15
- 1,434
- 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
... a ⁄ b domain than in the a domain [20].This is also reflected in the rigidity of the protein. The atomic displacement factors of the PhyK structure aresmaller for the a ⁄ b domain than for the ... coli phytase, glucose-1-phosphatase and human prostatic-acid phosphatase. The polypeptidechain is organized into an a and an a ⁄ b domain, and the active site islocated in a positively charged ... substrate-freeAppA the C a atoms are 2.41 A ˚apart, whereas for the substrate-free PhyK and the substrate-loaded AppA the averaged distance is only 1.87 A ˚.Distinct conformational changes were observed...
- 13
- 766
- 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... because of the absence of the catalyticsubunit ISP (Table 1). Figure 3A shows that a band of approximately 500 kDa was also found in this mutantstrain when the mitochondrial membranes were ana-lyzed ... dimerization of the bc1complex atthis stage (i.e. just after the addition of ISP and Qcr10p).On the other hand, in the transition from the 500 kDaband to the 670 kDa band, a structural rearrangement of ... were of analytical grade.Yeast strains and growth media The genotypes and sources of the S. cerevisiae strains aredescribed in Table 2. The ISP deletion strain wasprepared in accordance with the...
- 15
- 639
- 0
Tài liệu Báo cáo khoa học: ˚ The 1.8 A crystal structure of a proteinase K-like enzyme from a psychrotroph Serratia species docx
... SPRK also has an aspar-tic acid residue at position at 200, and with the sameconformation as in the two other structures, butAsp200 forms a salt bridge to Lys253 (Ala253 andAsn250 in PRK and ... [18]. The biophysical characteri-zation of SPRK did not reveal the classical cold adap-ted features [19], but still initial comparative studiesshowed that the catalytic turnover was at least ... reported.Results and discussionCrystallization, data collection and refinementCrystals of the catalytic domain of the Serratia prote-inase K (SPRK) grew within a few days to thin hexa-gonal plates growing...
- 11
- 551
- 0
Tài liệu Báo cáo khoa học: "The Utility of a Graphical Representation of Discourse Structure in Spoken Dialogue Systems" ppt
... system. Also, their underlying task (air travel domain) is much simpler than our tutoring task. In addition, the SIH is not always available and users have to activate it manually. Other visual ... hints/de-scribes the answer, each discourse segment has an additional purpose annotation that is displayed when the segment is part of the visible horizon. Auto-collapse. To reduce the amount of infor-mation ... also have an equivalent in a new domain (e.g. displaying the recognized user answer can be the equivalent of the correct answers). Other NM usages can also be imagined: e.g. reducing the length...
- 8
- 515
- 0
Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx
... Hospital and Regional Medical Center, Seattle, WA, USAProtein phosphatases are primarily classified on the basis of the type of the amino acid they dephosphory-late, serine ⁄ threonine phosphatases ... fused to an EF-hand motif, and human STP(HsSTP), which has an additional 8 kDa a- helicaldomain at the C-terminus [3,4]. The sizes of the catalytic domains of both PPP andPPM families are well ... kinase and adenylosuccinate syn-thase, but not in S. agalactiae CovR ⁄ CsrR. The motifis located at the surface of the SaPPase (Rantanen,unpublished), and superposition of the prolines allowssuperposition...
- 10
- 542
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GLU H44 7A forward (5¢- GCAAGTCATTTTGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAATGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTTAACAGATATGCCGGTTATT CCACCGGT ... as a template. The following oligonucleotides were used: GLUR1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAACTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢-GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTTTGAAT-3¢); ... GLUT46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCATATCTGTTAAGTTGTTC-3¢); GLU H44 7A, D45 0A for-ward (5¢-GCAAGTCATTTTGGATGCTATTAATGCTGATGGCTCCTTGAATGAAC-3¢), GLU H44 7A, D45 0A Fig. 7. Adsorption to raw...
- 11
- 548
- 0
ASSESSMENT OF THE BENEFITS OF EXTENDING THE TROPICAL RAINFALL MEASURING MISSION A PERSPECTIVE FROM THE RESEARCH AND OPERATIONS COMMUNITIES doc
... radarforecasting** inspace*• Another year of TMI data for • Improved forecasts from the operationalnumerical weather prediction** assimilation of PR and TMI data into• Another year of PR and ... NationalEnvironmental Satellite, Data, and Information Service Satellite Analysis Branch. The Satellite Analysis Branch uses TMI to augment other sources of data to theirreal-time, operational rainfall estimation ... in1. climate and weather research (e.g., a reliable seven-year climatolo-gy of the mean annual tropical rainfall and its interannual and diurnal cy-cles; fundamental new information on the synoptic...
- 116
- 303
- 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
... prevent.• Data manager changes data. A malicious data manager may change the value of its data on each cacherefresh. While this is an advantage for shared memory applications, it is a serious ... temporarily allow read-only access to cached data. The locking on a page may later be changed as deemednecessary by the data manager. [To avoid race conditions, the pager_data_provided call also ... to the default pager is identical to other external data managers, there are no fundamentalassumptions made about the nature of secondary storage. For example, the default pager may use local...
- 23
- 1,290
- 1
List the components of a radio system
... sent–Imprints a unique address on the data– The longer the code is, the more users will be able to share the same channel–Number of chips in the code•Determines the amount of spreading or bandwidthWireless ... (TDMA)–Divides the transmission time into several slots–Each user is assigned the entire frequency for the transmission•For a fraction of time on a fixed, rotating basis–Advantages•Uses the bandwidth ... strength falls near the level of noise–Interference can take place•To reduce the interference of noise–Boost the strength of the signal–Use of filters when receiving the signal•Attenuation–A...
- 30
- 920
- 0
Cambridge.University.Press.Africans.The.History.of.a.Continent.Aug.2007.pdf
... lineages of mitochondrial DNA exist among the San (‘Bushmen’) of southern Africa and the Biaka Pygmies of the modern Central African Republic. About 100,000 yearsago, some of these anatomically ... common in the East African highlands by 20,000 yearsago, appeared at that date also in southern Africa, spread into western andnorthern Africa during the next 10,000 years, and thereafter became ... that it awaits further confirmation.8 The forest margin of Cameroun and Nigeria was the region from whichBantu speakers gradually expanded throughout the southern half of Africa. AllBantu languages...
- 386
- 1,222
- 4
Guest the meaning of a word
... guest the meaning of a word Could you guest the sign of a new word? Yes, Of couse. This is 20 prefix and 14 root-word helping you improve your vocabulary.You can guest the meaning of 14.000 ... hurl, cast)].offer: ob-và ferre [Gồm các biến dạng fer và lat (Latin: line, bring, carry)].insist: in-và stare [Các biến dạng c a stare là sta, stat, sti, và sist (Greek: standing, stay,make ... talk,speech, speak; word)].aspect: ad-và specere [Gồm có 2 dạng spec và spic (Latin: see, sight, look, appear, behold,and examine)].uncomplicated: un-, com-,và plicare [Có 11 biến dạng sau:...
- 2
- 871
- 1
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... and Methods: The data obtained from all of the four university hospitals, and one referral tertiary-care educational state hospital in Ankara. Antimicrobial resistance profiles of 14,233 selected ... Hospital setting and antibiotic policy: NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper of the ... we have esca-lated all antibiotic prices. The cost of antibiotics was calculated as US dollars (USD). Statistical Analysis: Rates in every 6 months periods of the study period were analyzed...
- 6
- 692
- 0
The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company
... wise to adopt the internal law as governing law to the contract. On the other hand, the parties can agree toadopt a certain world law regarding international trade that can listed here as CISG(Convention ... aninternational transaction. Unless parties are assured that the coverage is available in the amount designated, the failure of a party to obtain insurance coverage shouldnot be grounds for termination of ... in anamicable way. If the parties fail to read an agreement in such way, the dispute shall be brought to the Central of the International Arbitration under Chamber of Commerce and industry of...
- 41
- 614
- 0
- the bedrock of a culture
- the benefits of trade
- are stimulated by extracellular matrix proteins such as type i collagen previous studies have demonstrated the involvement of a dggryy sequence located within the a1 chain cterminal telopeptide in type i collageninduced pmn activation
- the knight of a new crusade
- the return of a prodigal
- the confessions of a diner
- the story of a bad boy
- graphs the degree of a vertex
- the benefits of hierarchical network design
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25