... important internal partnerships? • What traits of an internal partnership are most important to achieving results? • What are the primary obstacles to effective internal partnerships? • What are the ... players • Disciplined: Where there sa will, there sa win 17 Essential Qualities (cont.) • Enlarging: Adding value to teammates is invaluable • Enthusiastic: Your heart is the source of energy ... issues related to achieving profitable CRA results? Survey – Most Important Internal Partnerships? NCC CDC/CDA Specialty Lending Mortgage origination Retail mgmt Comm/Investment RE Small business...
... employers Public service providers Governmental entities GSEs Real estate professionals Trade associations Collaboration in Practice • • • • • Specialty lending goals/business plans Homeownership ... together agreeably Collaboration is working together aggressively.” External Partners inthe neighborhood!” • • • • • • • • • Housing counselors Housing related non profits Small businesses Other employers ... Lack of communication • Lack of appropriate follow up • Silos – getting all lines of business to work together simultaneously • Budget • Lack of support staff Survey – Key Issues Related to Achieving...
... Audience referral sources (traditional & non-traditional) Materials designed for use by CRA, CDA & mortgage Objectives provide industry updates, discuss other topics of interest, stimulate ... discuss other topics of interest, stimulate followup “You hit home runs not by chance, but by preparation.” -Roger Maris ...
... conformational spaces ofa and b-amino acids, grid searches were performed and the generated structures were superimposed with canonical conformations of a- amino acids The atoms used inthe rmsd calculation ... ¼ for each peptide The percentage of degradation was calculated by comparing the area ofthe peaks ofthe intact peptide at t ¼ and t ¼ 60 Binding assays Binding assays were carried out at 22 ... because [Pro9]SP is as potent as SP Ca monomethylation of Gly9 drastically increases the affinity for the NK-1m binding site of [Ala9]SP, supporting the formation ofa new stabilizing interaction...
... of coffee are in one place, chests of tea in another, hogsheads of molasses and sugar, and various other kinds of goods are distributed all over the place Some boys are playing "tag," and they ... too, for the safe-keeping of stolen articles of all kinds An instance ofthe daring and ingenuity of these "wharf rats," as well as an illustration of some of their methods, is furnished inthe following: ... guess what had become of him In some portions ofthe town, garrets are made use of as club-rooms and places of rendezvous, and are exceedingly well arranged These places are used as storehouses,...
... as it passes through nasal turbinates, resulting ina general decrease in bites This, in turn, would cause a reduction in vectormediated parasitosis and infectious diseases Evaluation ofthe third ... with a rabbit serum raised against HNE–protein adducts Ligandbinding tests showing the functionality ofthe same HNE-treated porcine (B) and bovine (C) OBPs as inthe immunostaining The plots show ... tree, nasal mucosa and sweat glands [25] Human tear lipocalin has significant sequence homology with the human forms of OBP and, at least in humans, partially shares a similar tissue distribution...
... Lepidoptera, the treatment of adults with the ACE inhibitor, captopril, causes a decrease in egg-laying [9] In Haematobia irritans exigua, a blood meal initiates the strong synthesis of ACE inthe testes, ... every isoform displays a transmembrane region Knowing whether all isoforms in Astacus are membrane bound proteins is interesting because it raises questions about both the evolution of ACE in different ... Immunohistochemistry: (D) Inthe testis, staining is present on the membranes of mature spermatozoids (spz), whereas spermatogonia are unstained (E, F) Inthe cross section of vas deferens, staining...
... number of Cách diễn đạt mang tính tương đối trang trọng Sau A large amount ofagreat deal of danh từ không đếm Ví dụ: * She has spent agreat deal of time in Europe Sau A large number of trước danh ... Plenty of mang ngh a : “đủ nhiều n a , theo sau danh từ không đếm danh từ s nhiều Ví dụ: * There is plenty of time * Plenty of shops accept credit cards A large amount of, agreat deal of , a large ... most, mặt ngữ pháp không hẳn giống Theo sau từ a lot, lots, plenty, a large amount agreat deal giới từ Of Ví dụ: * Plenty of shops open on Sunday mornings (không phải là: Plenty shops …) * Many...
... indicate their answers either verbally or using a hand scale (0 = closed fist, = all fingers open) The responses use a combination of high score = best status and low score = best status as a mechanism ... Palliative Care Association of South Africa Assessing construct validity ideally involves comparing a measure with a different measure ofthe same construct that has previously been validated inthe ... 1) Participating Sites The validation was undertaken in palliative care sites, in South Africa and in Uganda, based in rural, periurban and urban areas, including homecare, day care and inpatient...
... All statistical analyses were conducted using SPSS 11.0 software (SPSS, Inc., Chicago, IL) We applied separate × (cognitive task × sensory condition) repeated measures analyses of variance (ANOVA) ... algorithm uses the peakto-peak amplitude (range) of COP AP displacement to estimate the amount of postural sway inthe AP plane Scores are calculated as the angular difference, expressed as a percentage, ... values and ES to detect a change in postural control associated with the performance ofa secondary cognitive task The ability to stand as still as possible was evaluated under single task (standing...
... Summary Analysis figures for Rasch analyses ofthe NFI:MND Item Residual Analysis Name 1.Energy Initial Energy Final Weakness Initial Weakness Final Summary Initial Summary Final Ideal Values # of ... the simple duality ofthe ‘Weakness’ and ‘Energy’ subscales will also assist clinicians in assessing what patients mean when they describe feelings of fatigue As such 16 the NFI-MND fatigue scale ... this manner may have caused the sample to be skewed toward patients who were at early stages ofthe disease rather than those nearing the end stage ofthe disease, although ALSFRS-R scores suggested...
... number of Cách diễn đạt mang tính tương đối trang trọng Sau A large amount ofagreat deal of danh từ không đếm Ví dụ: * She has spent agreat deal of time in Europe Sau A large number of trước danh ... Plenty of mang ngh a : “đủ nhiều n a , theo sau danh từ không đếm danh từ s nhiều Ví * * dụ: There Plenty is of shops plenty accept of time credit cards A large amount of, agreat deal of , a large ... mang ngh a tương tự như: much, many most, mặt ngữ pháp không hẳn giống Theo sau từ a lot, lots, plenty, a large amount agreat deal giới từ Of Ví dụ: * Plenty of shops open on Sunday mornings...
... childhood Aa large number of B agreat deal of C a few D many 28) Peter has spent time and money on stamp collecting Aa few of B many of C agreat deal of D a large number of 29) I have got ... 2011 A so much B a few C so many D many 26) my students are familiar with this kind of school activities A Most B Most of C A few D Few 27) He had spent time writing an essay about his childhood ... there water inthe glass? A any B some C many D lots of 35) Peter doesn’t want to A something B anything C nothing D everything 36) Can you speak French? – Yes, Aa few B few C a little...
... lamina fromthe lamina base to the widest point, number of lobes, number of intercalary veins, basal shape ofthe lamina and abaxial lamina pubescence) were assessed on five fully expanded and ... hybridization might also be a result of different sampling strategies, sample sizes and data analysed in different ways, which makes it difficult to generalise from and compare studies Results froma recent ... species as a clear indication of true speciation Also, the facts that the two species occupy different edaphic habitats in Denmark, and that a nationwide allozyme study of 26 Danish populations has...
... investigate the relation oftheS equi subsp zooepidemicus strains the 43 isolates and the six previously Fig Typical fragments ofthe PCR amplified 1 6S rRNA gene oftheS equi subsp zooepidemicus strains; ... diseased pigs and monkeys in Indonesia J Clin Microbiol 1996, 34, 22012204 16 Stableforth AW Streptococcal disease In: Stableforth AW, Galloway IA (eds.) Infectious Disease of Animals Disease ... two isolates from Java from diseased pigs These Persistent occurrence of Streptococcus equi subsp zooepidemicus inthe pig and monkey in Indonesia results indicated that the mucoid S equi subsp...
... 1(CATGCCATGGGTCACCACCACCACCACGCTATAAGTGAAAATTTGGTCAAAGTTGTG) and primer (CCGCTCGAGTTATATCGATACAC TATTTGGAAC) - primer (CATGCCATGGCAGC TATAAGTGAAAATTTGGTCAAAGTTGTG) and primer (CCGCTCGAGTTATATCGATACACTATTT GGAAC) - primer ... the TomLoxC cDNA, total RNA from leaves of tomato treated with Bacillus subtilis M4 was used TomLoxF cDNA was first obtained from total RNA of methyljasmonate-treated tomato leaves Firststrand ... AtLOX3, NALOX3, and StLOXH3, all similarly involved in JA biosynthesis, are closely related On the basis of these similarities, it was suggested that TomLOXD possesses a linolenate-consuming lipoxygenase...
... data were entered into a single, electronic database Statistical Analysis was done with Statistica version software (Statsoft, Inc 2009) As some ofthe data was descriptive in nature, results ... visits The team was based at Stikland Hospital This held both advantages and disadvantages On the one hand, the team was able to draw fromthe various resources inthe hospital setting to strengthen ... assessments of new patients 250 Workstyle Key workers act as care coordinator bur caseloads are shared Individual caseloads Site of most visits >50% contacts are home visits Office based Engagement...
... vulnerable population continues to be at increased risk of transmission of blood borne infections and abcesses, and suffers froma lack of access to health care and social services Page of Strengths ... reported increases in risk behavior such as needle reuse as well as a dramatic decrease in access to services Contacts with vulnerable clients have been lost and thousands of needles are unaccounted ... other areas ofthe community Changes in Access to Services As outlined above, the hours of service for needle exchange and access to nursing services and other housing and social services have...
... to the Rasch analysis, to be analysed on a domain-specific basis and also to test if an overall summary scale could be derived Rasch Analysis Rasch analysis is a modern psychometric approach ... validity ofthe fit across both the samples The Physical, Cognitive, and Summary scales all achieved a level of reliability necessary for use in individuals Targeting The final scales displayed ... estimates are converted to the same range as the raw score by a further simple linear transformation This nomogram can be used to obtain linear estimates fromthe raw scores of other samples...