testing for the presence of a key in a hash
o'reilly - perl cookbook
... Functions and Expressions Within Strings Indenting Here Documents Reformatting Paragraphs Escaping Characters Trimming Blanks from the Ends of a String Parsing Comma-Separated Data Soundex Matching ... fundamental unit for working with data is the scalar, that is, single values stored in single (scalar) variables Scalar variables hold strings, numbers, and references Array and hash variables hold ... double-precision floating-point notation Strings in Perl may be of any length (within the limits of your machine's virtual memory) and contain any data you care to put there - even binary data containing null...
- 1,096
- 1,310
- 0
Báo cáo y học: " Autonomic Dysfunction Presenting as Postural Orthostatic Tachycardia Syndrome in Patients with Multiple Sclerosis"
... hypothalamus and cerebral cortex Demyelinating plaques may disrupt reflex pathways in the insular, cingulated and ventromedial prefrontal cortices, central nucleus of the amygdala, paraventricular ... therapeutic management approach for these patients was based on our previous experience with the management of patients with POTS Initial therapy consisted of an increase in salt and fluid intake ... medication The data obtained are presented as mean ± standard deviation or as percentages where applicable Response to therapy Response to therapy was subjectively assessed in each patient None of...
- 6
- 478
- 0
Functions with multiple outputs
... Sorting Algorithms Linear Search A Simple Sort Faster Sorting Binary Search Pointers and addresses • Pointer: memory address of a variable • Address can be used to access/modify a variable from anywhere ... Sorting Algorithms Linear Search A Simple Sort Faster Sorting Binary Search 18 Strings as arrays • Strings stored as null-terminated character arrays (last character == ’\0’) • Suppose char str ... Outputs Arrays and Pointer Arithmetic Strings String Utility Functions Searching and Sorting Algorithms Linear Search A Simple Sort Faster Sorting Binary Search 15 Arrays and pointers • Primitive arrays...
- 41
- 184
- 0
Tài liệu Adding Records with a GUID Primary Key pdf
... by handling the RowChanging event for each table When a row has been added, that is, the Action property of the DataRowChangingEventArgs argument is Add, the DefaultValue for the primary key column ... property of the DataRowChangingEventArgs argument of the event handler The Action property is set to one of the DataRowAction values detailed in Table 4-2 Table 4-2 DataRowAction enumeration Value ... contains members to facilitate working with GUIDs The RowChanging event of the DataTable is raised when a DataRow is changing The action that occurred on the row can be determined by the Action...
- 4
- 340
- 0
Tài liệu Báo cáo khoa học: "Learning to Translate with Multiple Objectives" doc
... 2003 Minimum error rate training in statistical machine translation In ACL Karolina Owczarzak, Josef van Genabith, and Andy Way 2007 Labelled dependencies in machine translation evaluation In Proceedings ... Statistical Machine Translation P Liang, A Bouchard-Cote, D Klein, and B Taskar 2006 An end-to-end discriminative approach to machine translation In ACL Ding Liu and Daniel Gildea 2007 Source-language ... Arne Mauser, Sa a Hasan, and Hermann Ney 2008 s Automatic evaluation measures for statistical machine translation system optimization In International Conference on Language Resources and Evaluation,...
- 10
- 624
- 0
Tài liệu Báo cáo khoa học: "Extending the Entity-based Coherence Model with Multiple Ranks" pot
... Regina Barzilay and Mirella Lapata 2005 Modeling local coherence: An entity-based approach In Proceedings of the 42rd Annual Meeting of the Association for Computational Linguistics (ACL 2005), pages ... ordering In Proceedings of the 41st Annual Meeting of the Association for Computational Linguistics (ACL 2003), pages 545–552 Mirella Lapata 2006 Automatic evaluation of information ordering: ... Regina Barzilay and Mirella Lapata 2008 Modeling local coherence: an entity-based approach Computational Linguistics, 34(1):1–34 Danushka Bollegala, Naoaki Okazaki, and Mitsuru Ishizuka 2006 A...
- 10
- 363
- 0
Báo cáo khoa học: "Discourse Processing of Dialogues with Multiple Threads" pot
... machine translation In (Iida and Arita 1990; Kogura et al 1990), researchers at ATR advocate an approach to machine translation called illocutionary act based translation, arguing that equivalent sentence ... chains up to an instantiation of the Response operator from an instantiation of the Reject operator, it is assigned the speech act Reject Similarly, sentence chains up to an instantiation of the ... make that attachment according to the annotations in the plan operator of which this new action would become a child If an action on the active path is a repeating action, rather than only the rightmost...
- 8
- 266
- 0
Discovering Frequent Event Patterns with Multiple Granularities in Time Sequences docx
... maximum range appearing in the constraints, and p is the number of chains used in the construction of the automata The proof basically follows a standard technique for pattern matching using a nondeterministic ... for each state is the minimum between the length of the input sequence and the product of the number of variables in the chain and the maximum range appearing in the constraints If the graph is ... events in the input sequence, |V| is the number of variables in the longest chain used in the construction of the automata, K is the size of the maximum range appearing in the constraints, and p...
- 16
- 395
- 0
Báo cáo khoa học: "American Sign Language Generation: Multimodal NLG with Multiple Linguistic Channels" pot
... thinking of channels as dividing a communication signal, we can think of them as groupings of individual values in the data stream that are related in some way The channels of a multimodal NLG system ... North American chapter of the Association for Computational Linguistics annual meeting: HLT/NAACL 2004, Boston, MA, USA Huenerfauth, M 2004b Spatial and Planning Models of ASL Classifier Predicates ... speaking ECA character that performs meaningful gestures (Kopp et al., 2004) has similarities to this ASL project First of all, the channels in the signal are basically the same; an animated human-like...
- 6
- 200
- 0
Báo cáo khoa học: "DEDUCTIVE PARSING WITH MULTIPLE LEVELS OF REPRESENTATION*" pptx
... 4: The Structure of the PAD Parsers The clause defining the 'parse" relation given in Figure as part of the axiomatization of GB theory is the actual Prolog definition of 'parse' used in the PAD1 ... capable of deriving the consequences of af that follow in the theory of Universal Grammar Thus the PAD parsers have the logical structure diagrammed in Figure The Case Filter as formulated in ... in a specialized logical language, and the lexicon and rarameter values that constitute the specific knowledge of a human language beyond Universal Grammar as a set of formulae in that logical...
- 8
- 269
- 0
Assessment and Management of the Elderly Patient with Multiple Sclerosis pot
... supports the diagnosis of disseminated in space To demonstrate the concept of disseminated in space, a single scan that contains both gadolinium-enhancing and non-enhancing lesions in regions typical ... interpersonal therapy approaches) Behavioral activation, engagement in pleasurable activities, and physical activity are also key in promoting a stable Referral to a Rehabilitation Psychologist is indicated ... For example, the neuropathy of diabetes consists of pain and paresthesias beginning distally and spreading proximally in a typical glove and stocking distribution Also, retinopathy can lead to...
- 11
- 508
- 0
Báo cáo khoa học: CmtR, a cadmium-sensing ArsR–SmtB repressor, cooperatively interacts with multiple operator sites to autorepress its transcription in Mycobacterium tuberculosis pptx
... TGTTATACCAGTATATGGTGTACTA CTCGGCCTCAACTACAGTCGT ACAGGTAGCTGAGCAGCAGAC CAGCTAGCTGGCCGGGATAGC P1F P1R GCCGATCATATCTGCTATGG CCATAGCAGATATGATCGGC P2F P2R ATGTACAATTCAGCTCTTGCT AGCAAGAGCTGAATTGTACAT ... P3F P3R GCTGTTATACCAGTATATGG CCATAT ACTGGTATAACAGC P4F P4R TGGTGTACTAATTTGATCTATG CATAGATCAAATAGTACACCA H1 CGAGTCGACCGGAGGACCTTT GGCCCTGCGTCGACCGA TCGGTCGACGCAGGGCCAAAG GTCCTCCGGTCGACTCG H2 Experiment ... DNA was obtained from the TB Research Materials and Vaccine Testing program of the US National Institute of Allergy and Infectious Diseases (Grant A1 -75320) The technical assistance of Mr Shailendra...
- 12
- 462
- 0
Báo cáo khoa học: "Joint Decoding with Multiple Translation Models" docx
... capture a large amount of linguistically unmotivated mappings due to syntactic constraints Another reason is that the tree-to-string model only used part of the training data because of parsing failure ... As a general representation, a translation hypergraph is capable of characterizing the search space of an arbitrary translation model Furthermore, it offers a graphic interpretation of decoding ... Comparison of individual decoding, system combination, and joint decoding 5.3 Max-derivation 30.70 31.63 Individual Training Vs Joint Training Table shows the effects of individual training and joint...
- 9
- 295
- 0
Imputation Methods to Deal with Missing Values when Data Mining Trauma Injury Data pot
... mean performance of the five validation data sets In many data mining efforts the evaluation criterion is the overall accuracy i.e the percentage of correct classifications made by an algorithm, ... significant in the training models, and all training models included at least two of the GCS scores Ten factors included in a typical ANN training model are listed in order of importance (Table ... Chesney D, Maffulli N, Templeton J Data mining medical information: Should artificial neural networks be used to analyse trauma audit data? Int J of Healthcare Information Systems and Informatics 2006;...
- 6
- 510
- 1
Báo cáo khoa học: "Text Segmentation with Multiple Surface Linguistic Cues" pptx
... h a t lexical chains tend to indicate portions of a text t h a t form a semantic unit We use the information of the lexical chains and the gaps of lexical chains that are the parts of the chains ... that clustering a set of the training texts and calculating the weights for each cluster, rather than calculating the weights for the entire set of texts, might improve the accuracy In the area ... (such as the indentation) at all due to the following two reasons: Many of the exam question texts have no marks of paragraph boundaries; In case of Japanese texts, it is pointed out that paragraph...
- 5
- 181
- 0
Báo cáo khoa học: "TEXT UNDERSTANDING WITH MULTIPLE KNOWLEDGE SOURCES: AN EXPERIMENT IN DISTRIBUTED PARSING" docx
... complete the task, it will send back to the CM a message containing an alarm, causing in such a way a change in the priority of the semantic analysis problem, that will become Fatal The other three ... types of messages, namely: prob/ems, solutions, and alarms as already outlined above integrate all the information useful to actually build up the BLR/ELR representation of the meaning of the text ... restructuring of the whole system, the robustness that can be achieved by overlapping the capabilities of different specialists the facility in designing and debugging, The main problem in adopting a...
- 5
- 217
- 0
channel adaptive technologies and cross layer designs for wireless systems with multiple antennas
... systems With the availability of perfect channel state information (channel matrix), power adaptation (in both the temporal and spatial domains) and rate adap- Adaptive channel encoder Adaptive power ... sufficiently separated so that they are spatially uncorrelated The advantage of having multiple antennas at the transmitter and the receiver is to transform the original wireless fading channels into multipleinput ... important and fundamental concepts of entropy, mutual information, and channel capacity, which are critical to the understanding of the materials and approaches in the subsequent chapters Finally, in...
- 544
- 313
- 0
báo cáo hóa học: "The impact of regular physical activity on fatigue, depression and quality of life in persons with multiple sclerosis" pot
... eral assessment of fatigue Higher scores indicate that fatigue has a greater impact on the individual The MFIS has been suggested as a useful measure of fatigue in MS research and clinical practice ... was involved in the concept and design, data collection and collation, data analysis, writing and editing of the manuscript CM was involved in the conception and design of the study, as well as ... moderate MS Perhaps in persons with mild MS, the physical limitations of the disease are minimal and therefore irrespective of exercise status the impact of the disease on QoL in the physical domain...
- 10
- 683
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25