0

subtract the result of step c from 100 for example

Tài liệu Báo cáo khoa học: Glucuronate, the precursor of vitamin C, is directly formed from UDP-glucuronate in liver pptx

Tài liệu Báo cáo khoa học: Glucuronate, the precursor of vitamin C, is directly formed from UDP-glucuronate in liver pptx

Báo cáo khoa học

... initiation of the reaction by addition of UDP-glucuronate and UDPGlcNAc to measure glucuronate Fig Requirement of a heat-stable cofactor for the effect of metyrapone (MP) and other xenobiotics on microsomal ... the formation of free glucuronate from UDP-glucuronate observed in this preparation could be the result of a glucuronidation– deglucuronidation cycle, with a hypothetical acceptor present in the ... UDPglucuronate influx into microsomes [11] This involves conversion of UDP-glucuronate to UMP in the lumen of the vesicles and exchange of the latter with cytosolic UDPGlcNAc Once inside microsomes,...
  • 12
  • 659
  • 0
The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning

The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning

Môi trường

... is cooled by the water evaporation from the outerwall of the bricks into that air The cooling capacity of the device depends on the amount of evaporated water from the humid surface into the ... “semi-indirect” The second case is characteristic of tropical climates, and this situation can result into condensation of part of the outside air humidity, due to the low humidity of the stuffy ... through the call for scientific research and technological development research projects Reference number ENE2008-02274/CON Prof Francisco Javier Rey would like to thank the Consejería de Educación,...
  • 28
  • 652
  • 0
A STUDY ON THE TRANSLATION OF ACCOUNTING TERMS FROM ENGLISH INTO VIETNAMESE

A STUDY ON THE TRANSLATION OF ACCOUNTING TERMS FROM ENGLISH INTO VIETNAMESE

Khoa học xã hội

... and receipts of business transactions by cash, check or credit card Cash discount It is a refund of some fraction of the Chiết khấu tiền amount paid because the purchase price mặt is paid by the ... the principle of Bút toán kép accounting which requires that every transaction has two effects one of which is a debit and the other of which is a credit of the same amount II.ACRONYMS IN ACCOUNTING ... able to answer The third difficulty is the large scope of accounting terms and translator cannot cover all sectors of accounting Therefore, translators are confused when facing to accounting terms...
  • 61
  • 1,164
  • 7
A STUDY ON THE TRANSLATION OF WEATHER TERMS FROM ENGLISH INTO VIETNAMESE

A STUDY ON THE TRANSLATION OF WEATHER TERMS FROM ENGLISH INTO VIETNAMESE

Khoa học xã hội

... for Academic purpose (EAP) - English for Occupational purposes (EOP) And example of EOP for the EST branch is English for technicians whereas an example of EAP for the EST branch is English for ... about the characteristics of terminology among terminologists Some say the typical characteristic of terminology is the systematic formation, whilst others claim that it is the feature of content ... Sea surface SST(Nhiệt độ mặt n- c temperature biển) CB Cumulonimbus cloud CB (Mây vũ tích) NHC National hurricance NHC (Trung tâm bão qu c center gia) WFO Weather forecast office WFO (C quan...
  • 55
  • 831
  • 3
Tài liệu 13 Days The Chronicle of an Escape from a German Prison doc

Tài liệu 13 Days The Chronicle of an Escape from a German Prison doc

Khoa học xã hội

... employed there and cut off from the prisoners' part of the camp by closing the iron gate in the main wire wall of the camp It occurred to me that if I could hide in the parcel office or tin room before ... of the camp enclosure to the door of this office, thus enabling them to permit the prisoners free access to these two rooms until this hour At o'clock the offices were cleared of prisoners by the ... one of the baskets could be cut open from the inside, and the others could then be opened with the keys that the occupant of this basket had on him At about eight o'clock the German officer arrived,...
  • 71
  • 446
  • 0
Tài liệu Determining the Cost of Producing Ethanol from Corn Starch and Lignocellulosic Feedstocks pot

Tài liệu Determining the Cost of Producing Ethanol from Corn Starch and Lignocellulosic Feedstocks pot

Cao đẳng - Đại học

... shows the production cost breakdown for each process The largest cost contributor in the corn starch process is the feedstock; for the lignocellulosic process it is the depreciation of capital cost, ... shows the production cost breakdown for each process The largest cost contributor in the corn starch process is the feedstock; for the lignocellulosic process it is the capital cost, which is ... bushel the cost of the corn required to produce a gallon of fuel ethanol is $0.68 For a dry milling facility that is selling only DDG, the net cost of corn, which is the cost of the corn entering the...
  • 44
  • 762
  • 0
Tài liệu Interactions Between Workers and the Technology of Production: Evidence from Professional Baseball doc

Tài liệu Interactions Between Workers and the Technology of Production: Evidence from Professional Baseball doc

Tự động hóa

... than the coefficient estimates in other specifications For pitchers, the fixed-effect results are in column (5) of Table while the first-difference results appear in column (6) of Table The pitching results ... performance increases with the pitching performance of the other pitchers on the team, but is unaffected by the batting performance of the team The differential reaction to both types of players from ... So, the differential responses according to the role of each type of player can be viewed as evidence for the idea that the technology of production significantly influences the interaction of effort...
  • 33
  • 436
  • 0
The analysis of vitamin c

The analysis of vitamin c

Hóa học

... source will make it easier to see the bottom of the meniscus), add mL of starch indicator to the first ascorbic acid sample and titrate with the iodine solution Note the change of the I2 color ... parameter called the titer -the number of mg of ascorbic acid which reacts with ml- of iodine solution This number is easily found from the I2 concentration and the mass relationship in the reaction ... ascorbic acid Using a 0 .1000 -g sample of pure ascorbic acid, 25.32 mL of I2 were required to reach the starch end point a What is the molarity of the iodine solution? b What is the titer of the...
  • 7
  • 729
  • 0
Revealing the costs of air pollution from industrial facilities in Europe pot

Revealing the costs of air pollution from industrial facilities in Europe pot

Điện - Điện tử

... acidity The health effects of SO2, NOX, NH3 and NMVOCs result from the formation of secondary particulate matter and ozone through chemical reactions in the atmosphere The possibility of direct ... damage costs A small number of individual facilities cause the majority of the damage costs Fifty per cent of the total damage cost occurs as a result of emissions from just 191 (or 2 %) of the ... of difference to analysis for the European population, whereas inclusion of chronic effects on mortality could greatly increase the overall significance of ozone impacts Revealing the costs of...
  • 74
  • 994
  • 0
Modeling the Departure of Military Pilots from the Services ppt

Modeling the Departure of Military Pilots from the Services ppt

Cao đẳng - Đại học

... constitute a cohort The file contains information on an officer at the time of accession (including demographic characteristics and characteristics of military employment, such as the DOD occupation ... In the Air Force, we included an indicator for African-American race in a specification check We found that the coefficient on this indicator is small and statistically insignificant (coefficient ... code) Appended to the accession data is information about the officer at the time of separation if the officer is no longer in the service, or information about the most recent year of service...
  • 86
  • 309
  • 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học

... GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A-3¢ The PCR product was cloned into the ... either because its concentrations were below the detection limit or because of the lack of the l-gulono-1,4-lactone substrate in these cells l-Gulono-1,4-lactone can be formed by the C1 reduction ... tuberculosis Steady-state parameters of the mycobacterial dehydrogenase determined for: (A) the L-gulono-1,4-lactone substrate in the presence of 121 lM cytochrome c; and (B) the cytochrome c substrate...
  • 11
  • 571
  • 0
Báo cáo

Báo cáo "Reseach on the removal of hexavalent chromium from aqueous solution by iron nanoparticles " doc

Báo cáo khoa học

... Fig Effect of initial Cr(VI) concentration on the rate of Cr(VI) removal efficiency Fig shows the results of effect of initial Cr(VI) concentration on the rate of Cr(VI) Fig shows that, Cr(VI) ... the concentration of Fe0 nanoparticles had effect on the reduction of Cr(VI) When the mass ratio of Fe0 to Cr(VI) was 50:1, 100% removal efficency was achieved pH has important effect on Cr(VI) ... initial Cr(VI) After 20 minutes, the removal is 100% at concentration of 2mg/l and 69.32% at concentration of 5mg/l When treatment time increased then Cr(VI) removal efficiency decreased The proper...
  • 5
  • 365
  • 0
RECOMMENDATIONS TO ECE GOVERNMENTS ON THE PREVENTION OF WATER POLLUTION FROM HAZARDOUS SUBSTANCES pot

RECOMMENDATIONS TO ECE GOVERNMENTS ON THE PREVENTION OF WATER POLLUTION FROM HAZARDOUS SUBSTANCES pot

Điện - Điện tử

... Manufacture of chemicals and chemical products ISIC 2411: Manufacture of basic inorganic and organic chemicals ISIC 2412: Manufacture of fertilizers and nitrogen compounds ISIC 2413: Manufacture of ... Manufacture of coke, refined petroleum products and nuclear fuel ISIC 231: Manufacture of coke oven products ISIC 232: Manufacture of refined petroleum products ISIC 233: Processing of nuclear ... plastics in primary forms and of synthetic rubber ISIC 2421: Manufacture of pesticides ISIC 2422: Manufacture of paints, varnishes and similar coatings ISIC 2423: Manufacture of pharmaceuticals,...
  • 5
  • 407
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Improving the Accuracy of Subcategorizations Acquired from Corpora" pdf

Báo cáo khoa học

... SCFs for the words in the resulting SCFs Recall = Correct SCFs for the words in the resulting SCFs All SCFs for the words in the test SCFs I then compare centroid cut-off with confidence cut-off ... frequency cut-off B: centroid cut-off* 0.05 C: centroid cut-off 0.05 D: confidence cut-off 0.05 0.8 0.8 D C B A 0.4 A 0.6 Recall Recall D 0.6 A: frequency cut-off B: centroid cut-off* 0.05 C: centroid ... observe the effects of clustering Figure shows precision and recall of the resulting SCFs using centroid cut-off 0.05 and the confidence cut-off 0.05 by varying the threshold for the confidence values...
  • 6
  • 317
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Learning the Countability of English Nouns from Corpus Data" ppt

Báo cáo khoa học

... extraction methods For each, in addition to the F-score and classification accuracy, we present the relative error reduction (e.r.) in classification accuracy over the majority-class baseline for ... agreement between the two resources in the form of classification accuracy That is, we calculate the average proportion of (both positive and negative) countability classifications over which the two methods ... plural form, such as goods They can neither be denumerated nor modified by much Many of these nouns, such as clothes, use the plural form even as modifiers (a clothes horse) The word clothes cannot...
  • 8
  • 349
  • 0
A study on the translation of technical terms from English into Vietnamese

A study on the translation of technical terms from English into Vietnamese

Khoa học xã hội

... shape off the open circuit characteristic curve is determined by the behaviour of the magnetic circuit of the generator The magnetic circuit being the path taken by the magnetic flux When the generator ... But the most important factor in acceptance of neologism is the motivation: the term should reflect the characteristic of concept it designates - Eponyms are the words which constructed with the ... the form of the term Instead, they result from: Expension: extending the meaning of a term by giving it a new meaning, as in shift from the concrete to the abstract or from the abstract to the concrete...
  • 52
  • 811
  • 2
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGTCTGCCCTGACTCAGCCTGC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCTTCTGAGCTGACTCAGGACCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC...
  • 11
  • 679
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25