steady state characteristics of a system
Báo cáo khoa học: Experimental and steady-state analysis of the GAL regulatory system in Kluyveromyces lactis docx
... per-formance of the GAL system. As KlGal1p plays a dualrole, as both inducer and galactokinase, our analysisindicates that only 10% of total KlGal1p translocatesinto the nucleus to act as inducer, ... used a steady- state modeling approach to quan-tify the underlying molecular mechanism for the GAL system of K. lactis and to obtain a systems’ levelunderstanding of its behavior. The steady- state ... GAL system of K. lactis was validated experi-mentally by obtaining steady- state protein expressionlevels in a wild-type strain and in a mutant strain lack-ing gene KlGAL80. The steady- state...
- 16
- 371
- 0
Báo cáo hóa học: " Procedure for the steady-state verification of modulation-based noise reduction systems in hearing instruments" doc
... been of interest withregard to the fact that practical systems have a limiteddynamic range. However, the synthesis of test signalsthat allow enforcing a signal feature like modulation hasonly ... via a digital-to-analog and an ana-log-to-digital converter. This is omitted for simplici ty inFigure 2.NLMS-based measurement As an improvement of theleast mean squares (LMS) algorithm that ... can also verify that theenvelope of the signal in the bottom subfigure is attenu-ated compared to cases with an inactive noise reductionsubsystem. The additional amount of attenuation shallbe...
- 20
- 415
- 0
Tài liệu Steady State Operation of DC Machines pptx
... RVkIRkITIVRVkIRkITaaafaaaafaefafaf a af a fefn fn fanfn a fne=+ = +ị=== ===()()22If both voltages have rated values then(13)Speed-torque characteristic, with rated voltages applied ... can be neglected and armature voltage is constant and equalto rated. Calculate rated torque and rated power of the machine whose data are given.If the motor now drives a load such that the armature ... the two calculated points.Solution:Note that parts a) and b) are the ‘exam’ version of the Example 1, with minor changes and additions! a) As rated voltage and rated armature current are known,...
- 12
- 527
- 1
Tài liệu World Bank, Inter-American Development Bank, and Subregional Development Banks in Latin America: Dynamics of a System of Multilateral Development Banks ppt
... Republic, Trinidad and Tobago, Uruguay, and Venezuela); CABEI in Belize, Costa Rica, the Dominican Republic, El Salvador, Guatemala, Honduras, Nicaragua, Panama; and Argentina and Colombia outside ... this, we use a great amount of quantitative data from the annual reports and financial databases of MDBs that the FORO Nacional Internacional research program has been tracking periodically. The ... subregion, and; CDB in Anguilla, Antigua and Barbuda, the Bahamas, Barbados, Belize, British Virgin Islands, Dominica, Grenada, Guyana, Haiti, Jamaica, Montserrat, St. Kitts and Nevis, St. Lucia, St....
- 35
- 481
- 0
Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx
... obtainedfor the glutaminase reaction in the presence of 0.1 mMeach of UTP and ATP-cS (data not shown). Apparently, thevalue of K a , kcat,1and kcat,2were similar regardless of theactive ... glutaminase activity of L. lactis CTP synthase. (A) Enthalpogram showing the recording of steady- state rates for the hydrolysis of glutamine at increasing substrateconcentrations measured as ... hydrolyze glutamine at a steady- state rate similar to the rate of GTP-activatedCTP synthesis, if the enzyme was incubated in thepresence of GTP, UTP and the nonhydrolyzable ATPanalog ADPNP [8]....
- 8
- 698
- 0
Báo cáo khoa học: "FINITE STATE PROCESSING OF TONE SYSTEMS" potx
... assimilation and neu- tralization may be compared, is in terms of a class of operations related to unification. The situation in autosegmental phonology is simpler than in syn- tax, in that each feature ... assimilation) are seen as variants of an elementary unification operation over feature tapes (linear unification phonology, LUP). The phenomena analysed are tone terracing with tone-spreading ... languages and suitable formal models for it. The languages investigated are Tern (Gur/Voltaic family, Togo) and Baule (Akan fami- ly, C6te d'Ivoire). Tone languages of other types, in particular...
- 7
- 333
- 0
Báo cáo Y học: The structure of the O-chain of the lipopolysaccharide of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia pot
... Escherichia; Hafnia alvei;diarrhea; neuraminic acid.Hafnia alvei is a Gram negative bacterium and a member of the family Enterobacteriaceae. There are reports of associ-ation of H. alvei with diarrhoea ... of a prototypaldiarrheagenic strain of Hafnia alveithat has characteristics of a newspecies under the genusEscherichiaReine Eserstam1, Thushari P. Rajaguru1,2, Per-Erik Jansson1, Andrej ... and it was therefore concluded that the samepolysaccharide was present. A hydrolysate of the upperphase, analyzed as alditol acetates, revealed asD-glucose,D-galactose,D-galactosamine,L-glycero-D-manno-heptose,andD-glucosamine...
- 7
- 463
- 0
Báo cáo khoa học: Analysis of the contribution of changes in mRNA stability to the changes in steady-state levels of cyclin mRNA in the mammalian cell cycle doc
... TGAGGAGGGACAAAACCTTGAA 700Reverse TCGGTCACTGCCAGCATTC 700Probe CCAACCACTATATTACACCAATGATGGAGCTGAA 100RanGTPaseS83456 Forward CAACAAAGTGGATATTAAAGACAGGAAAG 300Reverse TGGCAGAAATGTCATAGTACTGAAGATT ... CTCTATGTCGCACCACTGATAACCTGAGACCTT 150Cks2NM_025415 Forward CCGAAGAGGAGTGGAGGAGACT 700Reverse ATATGCGGTTCTGGCTCATGA 700Probe CATGTAATGAACCCATCCTAGACTCTGTTGGACA 150RanBP1NM_011239 Forward TGAGGAGGGACAAAACCTTGAA ... TCCTCACAGACCTCCAGCATCCAGGT 100Cyclin D2NM_009829 Forward CGTACATGCGCAGGATGGT 700Reverse AATTCATGGCCAGAGGAAAGAC 300Probe TTTGTTCCTCACAGACCTCTAGCATCCAGGT 100Cyclin D3NM_007632 Forward AAAGGAGATCAAGCCGCACAT...
- 13
- 338
- 0
Báo cáo Y học: Molecular and biochemical characteristics of a gene encoding an alcohol acyl-transferase involved in the generation of aroma volatile esters during melon ripening pptx
... mM,2lLdNTPs(10mMeach), 0.5 lLeachprimer 50 lM. CM-AAT1 was amplied by using RSB-5Â:5Â-CAAAGAGCACCCTCATTCCAGCC-3Â,andFSD-3Â:5Â-AGGAGGCAAGCATAGACTTAACG-3Â; CM-AAT2was amplied with RSB-5Â and FSA-3Â:5Â-GATAATTCCACACCCTCCAATTA-3Â; ... CM-AAT1is capable of transferring acyl residues into a variety of alcohols and CM-AAT2 is inactive towards the samesubstrates. CM-AAT1 has the same enzyme activity as a strawberry SAAT characterized ... FSA-3Â:5Â-GATAATTCCACACCCTCCAATTA-3Â; the internal standard wasamplied with act.5Â:5Â-gcactgaagagcatccggtacttc-3Â andact3Â:5Â-TGGGCACGGAATCTCAGC(TC)-3Â. The PCRprogramme was one cycle of 2 min at 95...
- 8
- 509
- 0
Combustion and emission characteristics of a natural gas fueled diesel engine with EGR
... because of the very lean mixture of gaseous-fuel and air at part load, and the associated poor fuel utilization efficiency. In such a case, large portion of natural gas escapes ... n m a n Combustion and emission characteristics of a natural gas-fueled diesel engine with EGRM.M. Abdelaal, A. H. Hegab ⇑Department of Mechanical Engineering, Al-Azhar University, ... because at low loads, a small amount of natural gas is being utilized, and as the diesel pilot amount is quantified as a percentage of its rated value at conventional diesel operation,...
- 12
- 573
- 0
báo cáo sinh học:" Forecasting the need for medical specialists in Spain: application of a system dynamics model" potx
... structures andinteractions of feedback loops, and consists of variablesfor cause and effect, and causal links. A causal link con-nects a cause variable with an effect variable by a linkwith a positive ... 2000.16. Mable A, Marriott J: Steady State. Finding a Sustainable Balance PointInternational Review of Health Workforce Planning Health Human ResourcesStrategies Division. Health Canada; 2001.17. ... num-ber of simulation steps along the time axis. System Dynamics makes extensive use of diagrams,especially of two types: causal loop, and stock and flow.Causal loop A causal-loop diagram identifies...
- 9
- 543
- 1
báo cáo hóa học:" Measuring outcomes in allergic rhinitis: psychometric characteristics of a Spanish version of the congestion quantifier seven-item test (CQ7)" pdf
... Barcleona, Spain; Michael Herdman, Lola Sanz,Josep-Mar a Manresa, Insight Consulting & Research, Barcelona, Spain; Mar a José Rosales, Medical Affairs, Schering-Plough, Madrid, Spain; VanesaGonzález, ... Hospital Vall de Hebrón, Barcelona, Spain; RamonaSoler, Allergology Department, Hospital Son Dureta, Palma de Mallor ca,Spain; Mê Teresa Audicana, Allergy Service, Hospital de Santiago, Vitoria,Spain; ... Fundación Jiménez Díaz,Madrid, Spain; Pablo Amat, Alfonso Malet, Allergology Unit, Al.lergocentre,Barcelona, Spain; Ignacio Antépara, Ignacio Jauregui, AllergologyDepartment, Hospital de Basurto,...
- 5
- 361
- 0
Báo cáo hóa học: " Microstructure and adhesion characteristics of a silver nanopaste screen-printed on Si substrate" pdf
... resistivity and the stronger adhe-sion of the printed Ag nanopaste.Additional materialAdditional file 1: The parameters of scratch test. A table listing thedetailed scratch parameters.AbbreviationsDSC: ... SouthKorea) was composed of Ag nanoparticles with a meansize of 24 nm, which were dispersed in a- terpineol matrixat a solid loading of 73% by weight. The shape of the Agnanoparticles was examined ... Ag nanopaste drastically changed from discreteand spherical Ag nanoparticles to continuous and con-solidated ones.Figure 5 plots the variation in the apparent density of the Ag nanopaste as...
- 6
- 477
- 0
Báo cáo hóa học: " European Union and German law on coexistence: Individualisation of a systemic problem" docx
... of multilateral voluntary agreements between landowners of a region.Landscape planningTaking Germany as a case landscape planning is aimedat (1) describing the present state and uses of naturalareas ... uses of naturalareas and landscapes, (2) defining objectives of natureprotection and landscape preservation, (3) evaluate thefactual situation and (4) elaborate measures in view of the defined ... theagricultural planning;2. because the non-GMO farmer must tolerate a cer-tain amount of contamination by GMO pollen, bearsthe burden of proof with regard to economicaldamages through a GMO farmer and...
- 6
- 269
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25