role of tumor necrosis factor alpha tnf a
hypoglycemia
... Hypoglycemia: case based Diagnostic approach to hypoglycemia Iatrogenic hypoglycemia Tumor- associated hypoglycemia Hypoglycemia Symptoms after fasting or skipped meals? Symptoms (only adrenergic) after ... mM Stepfather T2DM: glyburide Grandfather T2DM: insulin Hypoglycemia: Symptoms Sympathoadrenal: diaphoresis, warmth, anxiety, tremor, nausea, hunger, palpitations/tachycardia Neuroglycopenic: ... without any imaging Advised to avoid insulin, OHA Final Diagnosis: surreptitious use insulin +/- OHA Hypoglycemia: Family Hx of DM? Access to insulin? Access to oral hypoglycemia agents? Case...
- 49
- 702
- 0
Development of DMC controllers for temperature control of a room deploying the displacement ventilation HVAC system
... [19] Hasnain, S.M., Alawaji, S.H., A1 -Ibrahim, A and Smiai, M.S (1999), Application of Thermal Energy Storage in Saudi Arabia International Journal of Energy Research, vol 23, pp 117-124 [20] Zaheer-uddin, ... was created to simulate the temperature of the exterior wall of the room This temperature curve simulated the exterior surface and was assumed to be at a constant value of 320K A 3-D Cartesian ... Mechanical Engineering and Materials Science at Washington University in St Louis, MO, USA He is a Fellow of ASME, AIAA, IEEE, and SAE E-mail address: rka@wustl.edu Huijun Gao received PhD degree...
- 12
- 556
- 0
Tài liệu Báo cáo Y học: Functional analysis of DM64, an antimyotoxic protein with immunoglobulin-like structure from Didelphis marsupialis serum pdf
... ¸ ˜ ` Amparo a Pesquisa Estado de Sao Paulo and the Programa de ˜ ` ´ Apoio a Pesquisa Estrategica em Saude-Fiocruz We thank Patrı´ cia B ´ Jurgilas for her technical assistance We are grateful ... and M13R-agcggataacaatttcacacagg) were from Life Technologies, Inc All other chemicals were of analytical grade or higher quality Animals, venoms, and toxins D marsupialis specimens were caught ... sequenced using plasmid specific primers (M13F-cccagtcacgacgttgtaaaacg- and M13R-agcggataacaatttcacacagg) (LifeTechnologies) in both directions To amplify the upstream region of DM64 cDNA, including...
- 11
- 620
- 0
Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc
... GCGGCGACGGCGACGGCAAGAG CGGGGGAGCGGGCGATGACCT GCAGATGCGCGTGCCAGACC CGGCGCCAGTAGCCGACGAAG CGGGTGGCCGCCAAACTCG AGGAAGCGCGGTCAAGGGAGTCTC CGCAAGGCGCTGGCCGAGTTCA TGTGCAGCAGCGGGACGTAGTAGG GGAATTCCGCGCGCGGGTCTGGCTTCA ... primarily through cadaverine: beta-lactam producers also make alphaaminoadipate J Bacteriol 171, 299–302 Gil JA & Hopwood DA (1983) Cloning and expression of a p-aminobenzoic acid synthetase ... hybridization of ScaIdigested DNA A hybridization band of 4200 bp was obtained for the wild-type with a desA fragment (1372 bp) as probe, and a band of about 4220 bp was found for the mutant with aac(3)IV...
- 13
- 456
- 0
Báo cáo khoa học: A thermoacidophilic endoglucanase (CelB) fromAlicyclobacillus acidocaldariusdisplays high sequence similarity to arabinofuranosidases belonging to family 51 of glycoside hydrolases ppt
... Clostridium acetobutylicum ATCC 824: AAK81366, ORF CAC3436; Clostridium stercorarium: AAC28125, arabinofuranosidase; Cytophaga xylanolytica: AAC38456, arabinofuranosidase I; AAC38457, arabinofuranosidase ... (BH1874); Bacillus subtilis ssp subtilis str 168: CAA61937, arabinofuranosidase 1; CAA99576, arabinofuranosidase 2; Bacteroides ovatus: AAA50391, arabinosidase 1; AAA50393, arabinosidase 2; Bifidobacterium ... NCC2705: AAN24035, BL0181; AAN24368, AbfA1; AAN24945, BL1138; AAN24971, AbfA2; AAN25400, AbfA3; Caulobacter crescentus CB15: AAK23403, ORF CC1422; Cellvibrio japonicus: AAK84947, arabinofuranosidase;...
- 10
- 401
- 0
South Carolina Family Business Of the Year ppt
... 3200 characters or 500 words) South Carolina Small Business & Advocacy Awards 2013 Family Business of the Year FINANCIAL, SALES AND EMPLOYEE GROWTH DATA Growth Data for the Last Years Year definition ... owner(s): Nominated by: Title: Business/Organization: Address: Phone: Email: South Carolina Small Business & Advocacy Awards 2013 Family Business of the Year BIOGRAPHY OF PRINCIPAL(S) Profile must ... employees Average number of part-time and/or seasonal employees Total average number of employees Note: Finalists may be asked to submit financial reports verifying the responses above South Carolina...
- 8
- 237
- 0
Báo cáo hóa học: " Oral Delivery of DMAB-Modified DocetaxelLoaded PLGA-TPGS Nanoparticles for Cancer Chemotherapy" potx
... coumarin-6 was encapsulated instead of docetaxel DMAB-modified PLGA nanoparticles were prepared by the same method Characterization of Nanoparticles Size Analysis and Surface Charge Size and ... PLGA nanoparticles (ANP), unmodified PLGATPGS nanoparticles (BNP) and 5% DMAB-modified PLGA-TPGS nanoparticles (CNP) The design of the nanoparticle matrix material was made to take advantages of ... effects of TPGS and DMAB component of the nanoparticles in enhancing cellular uptake of the nanoparticles (2) The advantages in cancer cell viability of the 5% DMABmodified PLGA-TPGS nanoparticles...
- 10
- 249
- 0
Báo cáo y học: " Psychological response of family members of patients hospitalised for influenza A/H1N1 in Oaxaca, Mexico" pdf
... in Atlanta confirmed that a common novel influenza A virus had been detected in two Mexican samples; the one from Oaxaca, and another from La Gloria, Veracruz, and was similar to a strain isolated ... linear regression analysis was performed Statistical analyses were undertaken using the statistical package STATA, version 10 (2008; Stata Corporation, College Station, TX, USA) Statistical significance ... health research; all are at IMSS and are in the Faculty of Medicine at the Benito Juarez University of Oaxaca MT and KA are researchers in the Disaster Response and Resilience Research Group of the...
- 9
- 310
- 0
Báo cáo y học: "Characteristics of suicide attempters with family history of suicide attempt: a retrospective chart review" ppt
... The sample was composed of 173 (36.9%) males and 269 (63.1%) females, with an age range of 14 to 88 years and a mean of 38.1 years, standard deviation of 15.7 years (M = 40.6, SD = 15.7 years ... Iyengar S, Kolko D, Oquendo M, Birmaher B, Burke A, Zelazny J, Stanley B, et al.: Familial pathways to early-onset suicidal behavior: familial and individual antecedents of suicidal behavior Am ... limitation is that the situation of cohabitation at the time when a family member attempted suicide was unclear The third limitation is that some of the suicide attempters may have been unaware of...
- 7
- 302
- 0
Báo cáo y học: "Array comparative genomic hybridisation-based identification of two imbalances of chromosome 1p in a 9-year-old girl with a monosomy 1p36 related phenotype and a family history of learning difficulties: a case report" pps
... dysmorphism, clinodactyly of the fifth finger and mild learning disability The maternal grandmother was also assessed and was phenotypically normal The proband's father was not available for assessment, ... clinodactyly and short toes She had required grommets for treatment of glue ear and had hypermetropia An 11-week scan detected nuchal oedema and ventriculomegaly was detected on a later antenatal ... paternal sample was unavailable but FISH analysis of the mother, grandmother and siblings of the proband revealed a normal diploid compliment in each case for all of the investigated clones At present,...
- 6
- 376
- 0
Báo cáo khoa học: " Hepatitis C Virus infection in apparentenly healthy individuals with family history of diabetes in Vom, Plateau State Nigeria" ppsx
... and participated in the screening of samples for HCV A. A.C: Participated in the design and coordination of the research All authors read and approved the final manuscript Methods Study area and ... for liver enzymes (aminotransferases, specifically ALT and AST) to ascertain the degree of liver damage Statistical analysis Data obtained were analyzed using the SPSS software 10 11 12 13 14 ... GON, Nwankiti OO: Prevalence of Hepatitis C virus in apparently healthy individuals at Jos, Nigeria International Journal of Applied and Natural Sciences 2008, 4(1):37-40 Mason A, Lau J, Hoang N,...
- 6
- 291
- 0
Báo cáo khoa học: " Hepatitis C Virus infection in apparentenly healthy individuals with family history of diabetes in Vom, Plateau State Nigeria" pot
... and participated in the screening of samples for HCV A. A.C: Participated in the design and coordination of the research All authors read and approved the final manuscript Methods Study area and ... for liver enzymes (aminotransferases, specifically ALT and AST) to ascertain the degree of liver damage Statistical analysis Data obtained were analyzed using the SPSS software 10 11 12 13 14 ... GON, Nwankiti OO: Prevalence of Hepatitis C virus in apparently healthy individuals at Jos, Nigeria International Journal of Applied and Natural Sciences 2008, 4(1):37-40 Mason A, Lau J, Hoang N,...
- 6
- 245
- 0
Báo cáo y học: " Psychopathological status, behavior problems, and family adjustment of Kuwaiti children whose fathers were involved in the first gulf war" ppsx
... Occasional Scientific Specialized Series 31, 2007: Kuwait Society for the Advancement of Arab children Al-Hammadi A, Staer A, Behbehani J, Staer M, Aref M, Al-Turkait F, Al-Asfour A: The traumatic ... father's age, as well child's age and level of education (by level of trauma exposure groups), the association of parental characteristics with child outcome variables was also assessed by analysis of ... contributions FAA conceived and planned the study and supervised data collection, FAA and JUO did literature search, analyzed the data and wrote the manuscript All authors read and approved the manuscript...
- 12
- 355
- 0
Pathomechanistic characterization of DMT1 mediated manganese cytotoxicity implications in neurodegeneration
... likely to have a broad role in many aspects of cellular metabolism, unwarranted uptake and bioaccumulation of metal ions can cause a number of detrimental effects Essential metals can become systemic ... potentially mediate the earlier onset of neurodegenerative diseases (Markesbery, Ehmann et al 1984, Gaeta and Hider 2005, Salazar, Mena et al 2008) The aberrant accumulation of metal ions may also ... proteins for clearance via autophagy (Matsumoto, Wada et al 2011, Watanabe and Tanaka 2011) Generally, while polyubiquitination is needed for targeting of proteins towards proteasomal degradation, one...
- 233
- 435
- 0
THE ROLE OF DMSO IN THE REGULATION OF IMMUNE RESPONSES BY DENDRITIC CELLS
... important in the generation of classically activated macrophages involving the 12 activation of signal transducer and activator of transcription (STAT) pathway and the nuclear factor- κB (NF-κB) pathway ... biomarkers that may be useful for disease identification (Mosser and Edwards, 2008) (i) Classically activated macrophages Classically activated macrophages traditionally refer to macrophages that ... and guanine and abbreviated as A, T, C, and G respectively Other abbreviations employed are listed as below in alphabetical order Ab Antibodies Ag Antigen APCs Antigen presenting cells ATP Adenosine...
- 166
- 529
- 0
Cambridge.University.Press.Allegories.of.Union.in.Irish.and.English.Writing.1790-1870.Politics.History.and.the.Family.from.Edgeworth.to.Arnold.Oct.2000.pdf
... on language, and its representations of gender, class, and national formations as they shape and are shaped by matters of inheritance and property, Castle Rackrent exhibits a formal and thematic ... a wide variety of specific contexts – the creation of otherness as a material agent of imperial rule, the place of language as a site of both domination and opposition, the deployment of racial ... as a means of naturalizing power inequities, by making Irish and English ‘‘national character’’ a matter of blood, then they may also operate to disturb and alter the status quo Most dramatically,...
- 240
- 1,195
- 5
The Retinoblastoma Gene Family in Cell Cycle Regulation and Suppression of Tumorigenesis
... pathway: p16INK 4A loss of function in melanoma, T-cell leukemias, pancreatic and bladder carcinomas, amplification of cyclin D in breast, oesophagus and head and neck cancer, Cdk4 amplification ... Commission and the Netherlands Genomics Initiative References Ashizawa S, Nishizawa H, Yamada M, Higashi H, Kondo T, Ozawa H, Kakita A, Hatakeyama M (2001) Collective inhibition of pRB family proteins ... transition of a normal cell into a cancer cell Inactivation of pRb has been found in many tumor types in humans, including hereditary retinoblastoma and sporadic breast, bladder, prostate and small...
- 43
- 460
- 0
A study of idioms denoting family in english and vietnamese
... designed to analyze and describe syntactic and semantic features as well as some typical cultural characteristics of In this paper, the data are analyzed on the basis of semantic and syntactical perspectives ... investigate idioms that have contents Idioms have attracted many language researchers all over the related to the family and relationships of members in the family We world They are an important factor ... between teaching foreign languages and teaching idioms To understand the meaning of idioms we should have the basic knowledge of languages as well as know about their historical and cultural characteristics...
- 13
- 1,838
- 5
Tài liệu The Unix Family of Operating pdf
... rm filename Commands appear in boldface type (in this example, rm) You should type the command exactly as it appears in the example The variable parts (here, filename) will appear in italic type; ... the line of Unix releases that started at AT&T (the latest is System V Release 4), and another from the University of California at Berkeley (the last version was 4.4BSD) Some past and present ... & Associates, Inc gave information about Mac OS X and reviewed the section about it And Tim, thanks from Jerry for all your advice and support during my 12 years of writing for O’Reilly January...
- 8
- 490
- 0
Tài liệu 77 Introduction to the TMS320 Family of Digital Signal Processors docx
... AR(ARP) Y → ARP AR(ARP) - → AR(ARP) AR(ARP) - → AR(ARP) Y → ARP AR(ARP) + AR0 → AR(ARP) AR(ARP) + AR0 → AR(ARP) Y → ARP AR(ARP)-AR0 → AR(ARP) AR(ARP)-AR0 → AR(ARP) Y → ARP AR(ARP) +rcAR0 → AR(ARP) ... AR(ARP) AR(ARP) +rcAR0 → AR(ARP) Y → ARP AR(ARP)-rcAR0 → AR(ARP) AR(ARP)-rcAR0 → AR(ARP) Y → ARP ADD ∗ ADD ∗ -,Y ADD ∗ 0+ ADD ∗ 0+,Y ADD ∗ 0ADD ∗ 0-,Y ADD ∗ BR0+ ADD ∗ BR0+,Y ADD ∗ BR0ADD ∗ BR0-,Y ... Operations That Can Be Performed in Parallel with Indirect Addressing Notation Operation ADD ∗ ADD ∗ , Y ADD ∗ + ADD ∗ +,Y No manipulation of AR or ARP Y → ARP AR(ARP)+1 → AR(ARP) AR(ARP)+1 → AR(ARP)...
- 37
- 508
- 1
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25