0

proteomics for genetic and physiological studies in forest trees application in maritime pine

Báo cáo khoa học:

Báo cáo khoa học: "Genetic control of pulp and timber properties in maritime pine (Pinus pinaster Ait.)" docx

Báo cáo khoa học

... used in both the timber and pulp industries, involving different partners (forest owners, timber and pulp industrials) for whom different traits may be of interest Today, the maritime pine breeding ... growth In order to provide the background for initiating a breeding programme for wood quality in maritime pine, genetic parameters are being estimated for a large set of wood properties in a wide ... 55] and (2) increasing pulp yield Our results show that it is possible to obtain this type of result in maritime pine (e.g –1 and +1 unit respectively for lignin and α-cellulose content) In this...
  • 14
  • 398
  • 0
Báo cáo khoa học: LRRK2 in Parkinson’s disease: genetic and clinical studies from patients ppt

Báo cáo khoa học: LRRK2 in Parkinson’s disease: genetic and clinical studies from patients ppt

Báo cáo khoa học

... domain Because WD40 domain is involved in mediating protein–protein interactions, the LRRK2 G2385R variant may impact on interactions with substrates and ⁄ or regulatory proteins Preliminary studies ... of eosinophillic, intracytoplasmic and proteinaceous inclusions termed as Lewy bodies and dystrophic Lewy neurites in surviving neurons [2] For many decades, the relative in uence of genes and ... protein comprising (from N-terminal to C-terminal), armadillo (ARM), ankryn (ANK), LRR, Ras of complex proteins (ROC), C-terminal of ROC (COR), mitogen-activated protein kinase kinase kinase and...
  • 9
  • 490
  • 0
The Society for Cinema and Media Studies’ Statement of Best Practices for Fair Use in Teaching for Film and Media Educators ppt

The Society for Cinema and Media Studies’ Statement of Best Practices for Fair Use in Teaching for Film and Media Educators ppt

Sân khấu điện ảnh

... tend to weigh heavily in favor of the use being fair and non-infringing However, not every educational and noncommercial use is non-infringing; fair use analysis requires examining all of the factors ... APPENDIX A TEACH ACT RESPONSIBILITIES FOR DISPLAYING OR PERFORMING FILM AND MEDIA IN ONLINE INSTRUCTION Institutional Faculty Information Technology Your institution must be a government body ... principles for use of film and media in U.S classrooms and then sets out limitations and clarifications regarding certain uses The stated principles are critical to ensure a thriving film and...
  • 10
  • 533
  • 2
Báo cáo hóa học:

Báo cáo hóa học: " Use of Genetic Algorithms for Contrast and Entropy Optimization in ISAR Autofocusing" doc

Báo cáo khoa học

... smallest IE) and copying them into the next generation set The operation of combining is obtained by choosing two elements within the survivors and by genetically combining them The genetic combination ... elements are generated by “cloning,” “combining,” and “mutating” the surviving elements (remaining after the discard process) The operation of cloning is performed by choosing the most fit elements ... contract, and the Department of Information Technology and Electrical Engineering (ITEE) of the University of Queensland as a Visiting Researcher between 2001 and 2006 His research interests are in...
  • 11
  • 407
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Across-site heterogeneity of genetic and environmental variances in the genetic evaluation of Eucalyptus globulus trials for height growth" ppt

Báo cáo khoa học

... replicates Spacing (m × m) INTRODUCTION In recent years, there has been a considerable increase in the application of best linear unbiased prediction (BLUP, [12]) to evaluate genetic merit in forest ... Mullin T.J., Park Y.S., Estimating genetic gains from alternative breeding strategies for clonal forestry, Can J For Res 22 (1992) 14–23 [23] Patterson H.D., Thompson R., Recovery of interblock information ... between sites for effects in a Moreover, combining the data over all trials and fitting heterogeneous variances for all effects, the REML log-likelihood (LogL) for a model constraining the across-site...
  • 9
  • 392
  • 0
báo cáo khoa học:

báo cáo khoa học: " Exploring ethical considerations for the use of biological and physiological markers in population-based surveys in less developed countries" docx

Báo cáo khoa học

... clinical standards, and universal precautions for laboratory work have been adopted for field use Informed consent in health examination surveys has been most frequently obtained in writing in ... Globalization and Health 2005, 1:16 evaluation [8-10] Ethical issues in population-based surveys include informed safety, informed consent, confidentiality, and reporting findings of testing Globalization ... of standards creates a challenge for those standards and for feedback onto standards as practiced in the resource rich settings Scientific advances and technological innovations will continue...
  • 7
  • 384
  • 0
báo cáo khoa học:

báo cáo khoa học: " MoccaDB - an integrative database for functional, comparative and diversity studies in the Rubiaceae family" pdf

Báo cáo khoa học

... in the designing of the database, performed database system administration, integrated the bioinformatics tools in the application VP served as the principal investigator of the project, performed ... using CSS style sheets MoccaDB also integrates bioinformatics tools such as BLAST [10] and CMap [12] For an overview of the MoccaDB structure and interaction with the bioinformatics tools and ... useful for researchers looking for an optimal polymorphic marker set for genotyping populations of a given species If the objective is the selection of markers for refining mapping in an inter-specific...
  • 11
  • 601
  • 0
báo cáo khoa học:

báo cáo khoa học: " Genetic and transformation studies reveal negative regulation of ERS1 ethylene receptor signaling in Arabidopsis" pot

Báo cáo khoa học

... etiolated seedlings of ers1-2 etr2 ein4, ERS1p:ERS1 ers1-2 etr2 ein4, and etr2 ein4 Error bars indicate standard deviation L1 and L3: two independent ERS1 transformation lines Box indicates common ... used for topological prediction, and a non-conserved His-kinase domain, in which some consensus amino acid residues essential for His-kinase activity are lacking [11,20] Biochemical studies indicate ... air: seedlings germinated in air; AVG: seedlings germinated in the presence of AVG ein4 ers2 ers1 etr2 ers2 exhibited early flowering and rosette growth ceased (Figure 1D) Both the ers1 and ers2...
  • 14
  • 175
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "AAV-mediated gene therapy for metabolic diseases: dosage and reapplication studies in the molybdenum cofactor deficiency model" pps

Báo cáo khoa học

... day 40 after birth, the animals obtained a single intravenous tail vein injection containing various amounts of AAV-MOCS1 in phosphate-buffered saline First, we investigated the effect of a thirty-fold ... Donahue BA, Lin HF, Stafford DW, Patel S, Thompson AR, Nichols T, Read MS, Bellinger DA, Brinkhous KM, Kay MA: Correction of hemophilia B in canine and murine models using recombinant adeno-associated ... either intrahepatic or intravenous injection [5] Using the MOCS1 expression cassette in an AAV 1/2 capsid, we here studied the effect of systemic delivery by tail vein injections For this application...
  • 7
  • 252
  • 0
MOLECULAR AND PHYSIOLOGICAL STUDIES OF SALT TOLERANCE IN THE SALT SECRETOR MANGROVE AVICENNIA OFFICINALIS

MOLECULAR AND PHYSIOLOGICAL STUDIES OF SALT TOLERANCE IN THE SALT SECRETOR MANGROVE AVICENNIA OFFICINALIS

Cao đẳng - Đại học

... in 50ml chilled 100mM CaCl2, and incubated on ice for 30min Cells were again harvested by centrifuging at 5000rpm for 10min at oC, and finally resuspended in 1ml ice cold 100mM CaCl2 containing ... grown in Berlayer Creek, the largest intact mangrove forest in Singapore mainland is from Sungei Buloh Wetland Reserve to Kranji Dam In a study in 1946 mangroves covered an area of 117.3ha and ... CCATTAGGTGGCCAGCTCTC 24 Annotation Cloning Cloning Cloning Cloning qRT-PCR primers qRT-PCR primers Cloning Cloning Cloning Cloning qRT-PCR primers qRT-PCR primers Cloning Cloning Cloning Cloning qRT-PCR primers...
  • 218
  • 765
  • 0
Marketing Strategy for welding and cutting products in Namviet company.doc

Marketing Strategy for welding and cutting products in Namviet company.doc

Quản trị kinh doanh

... field The main industries: Trafficking machinery, equipment and spare parts Building materials business Transportation Mining Broker dealers and auction Installation of machinery and industrial ... selling, marketing and other policies, in charge directive selling for all of products by month, quarter Field study report – Dam Thi Le Minh Marketing Strategy for welding and cutting products in ... equipment protection In addition, this welding machine cutting equipment in the workshop in Field study report – Dam Thi Le Minh Marketing Strategy for welding and cutting products in Namviet company...
  • 26
  • 874
  • 4
TYPHOONS AND TECHNICAL SOLUTIONS RECOMMENDED FOR EXISTING AND NEW HOUSES IN THE CYCLONIC REGIONS IN VIETNAM

TYPHOONS AND TECHNICAL SOLUTIONS RECOMMENDED FOR EXISTING AND NEW HOUSES IN THE CYCLONIC REGIONS IN VIETNAM

Kiến trúc - Xây dựng

... Doors and windows: The doors and windows must be well closed during typhoon Sliding doors may also be used for easily closing and opening Door and window frames must be provided with steel nails for ... typhoons and inundation are one of the many factors causing hunger and poverty hindering the socio-economic development of Vietnam Therefore, planning and construction of houses and buildings against ... coastline Winds acting on this sub-region are generated from strong typhoons directly approaching the coastline between Hai Phong and Ninh Binh, the coastline of Thanh Hoa and the southern coastline...
  • 12
  • 584
  • 0
an entity-centric approach for privacy and identity management in cloud computing

an entity-centric approach for privacy and identity management in cloud computing

Cơ sở dữ liệu

... Services: They include three agents: SSA, TEA, and ASA The first agent, SSA, maintains a database of information about ABs This information is used for encrypting and decrypting sensitive data and metadata ... Web services in the system proposed for independent navigation of the blind and the visually impaired When submitting their location information to the cloud, a blind user (and, in fact, any ... It receives audit information from ABs, and records this information into a file for analysis by authorized entities3 (e.g., AB owners, or auditors) Get decryption information and host’s trust...
  • 7
  • 521
  • 0
Tài liệu Organization for Security and Co-operation in Europe - Ministerial Council pptx

Tài liệu Organization for Security and Co-operation in Europe - Ministerial Council pptx

Quản trị mạng

... security and was vital for integrating diversity They were therefore resolved to promote inter-cultural, inter-ethnic and inter-religious dialogue, respect and mutual understanding, and to combat ... the Forum for Security Co-operation on small arms and light weapons, establishing principles for controlling brokering, improving export controls of MANPADS and setting standard elements for ... Council, has a central role in the OSCE as a forum for political and security dialogue, for setting consensus-based, politically binding norms and principles and for promoting their implementation...
  • 91
  • 419
  • 0
Tài liệu A Marketing Guide for Small and Medium Sized Primary Forest Products Processors pdf

Tài liệu A Marketing Guide for Small and Medium Sized Primary Forest Products Processors pdf

Tiếp thị - Bán hàng

... www.na.fs.fed.us Northeastern Area State and Private Forestry A Marketing Guide for Small and Medium Sized Primary Forest Products Processors The information contained herein contained creates no warranty either ... customers by providing easier access to shipping information, product inventories, purchasing, discounts, company information, or product information If this information is on-line, the customer ... O’Dell and his operation can be found in the September/October 2003 edition of The Forest Industry Magazine 14 II Fundamentals of Marketing A Marketing Guide for Small and Medium Sized Primary Forest...
  • 92
  • 2,180
  • 0
Tài liệu Commercialization Prospects for Sorghum and Pearl Millet in Tanzania pot

Tài liệu Commercialization Prospects for Sorghum and Pearl Millet in Tanzania pot

Cao đẳng - Đại học

... improved by promoting production specifically for the industry This can be accomplished by formally or informally contracting for grain at the beginning of the planting season Contracting for production ... discussed for Darbrew above, including contracting for grain and the use of grain cleaning equipment Again, if millers are willing to work with farm communities at the beginning of the season, and ... market demand for sorghum and pearl millet Next, constraints limiting the use of these crops by Tanzania’s food and feed industries are outlined Finally, opportunities for expanding industrial...
  • 25
  • 423
  • 0
corporate social responsibility strategies for sustainable development for small and medium enterprises in the village of bac ninh province, vietnam

corporate social responsibility strategies for sustainable development for small and medium enterprises in the village of bac ninh province, vietnam

Sư phạm

... whole mind in the business - Create a basis for mobilizing resources, including, intellectual and material resources, financial resources, ensuring effective implementation of business in manufacture ... population and labor Labour structure in 2008 in Bac Ninh province has 56,683 employees in small and medium enterprises 36 In North and security in 2009 is 1024.3 thousand people Population increases, ... 5 GiaBinh 8 Lương Tai BacNinh 2 Total 62 54 Acquiculture 1 Figure 4.1 - The medium and small villages in BacNinh province in 2008 (Source: BacNinh Department of Trade in 2008) Businesses in the...
  • 69
  • 577
  • 0
IMES DISCUSSION PAPER SERIES - INSTITUTE FOR MONETARY AND ECONOMIC STUDIES BANK OF JAPAN pot

IMES DISCUSSION PAPER SERIES - INSTITUTE FOR MONETARY AND ECONOMIC STUDIES BANK OF JAPAN pot

Ngân hàng - Tín dụng

... in a purely forward-looking economy keep proper information on forward- and backward-looking properties using indicator variables regarding the zero lower bound on the nominal interest rate instead ... nominal interest rate binds in a standard New Keynesian model consisting of a forward-looking IS curve and forward-looking Phillips curve Their conclusions are qualitatively the same as in the former ... same as in the former studies mentioned above of a forward-looking IS curve and forward-looking Phillips curve and derive optimal targeting rules in a purely forward-looking economy They imply...
  • 37
  • 360
  • 0
Báo cáo khoa học: Structural origins for selectivity and specificity in an engineered bacterial repressor–inducer pair pdf

Báo cáo khoa học: Structural origins for selectivity and specificity in an engineered bacterial repressor–inducer pair pdf

Báo cáo khoa học

... the dimer interface The two effectorbinding sites present in the dimer are identical and, because the binding sites are located within the protein interface, each binding site is lined by residues ... for atc binding to the mutant His64Lys (4.7 kcalÆmol)1), the difference in binding energies for the ligands atc and 4-ddma-atc to the same mutant (1.28 kcalÆmol)1) and the difference in binding ... main chain of loop segment 100–105 that switches conformations upon effector binding is in an identical conformation in both structures and resembles that observed for induced TetR (Fig 1C) In...
  • 12
  • 501
  • 0

Xem thêm