nominated officer means a person who is nominated to receive disclosures under part 7 of the proceeds of crime act 2002 money laundering or part 3 of the terrorism act 2000 terrorist property
... cultural or nutritional factors It is also possible that the generally more active hypothalamic-pituitary-adrenal axis in women contributes toa greater variability in sleep quality among women of ... identical tothe one given tothe Moroccan women Internal consistency (Cronbach's alpha) for the PSQI total score was 77 (comparable Moroccan sample: 80 [3] ; German sample: 89 [20]; American sample: ... and expressed their wish for information instead of actual access to it The finding in the Moroccan sample may also be related to sociological issues like social networking, favouring information...
... validate the mechanism of induction of GAL genes by galactose In each ofthe models, cytoplasmic Gal3p is activated by galactose Further, Gal4p dimerizes and interacts with the DNA to form the ... expression of GAL genes in response to galactose The GAL genetic switch The GAL regulatory network is composed of three regulatory proteins: a transcriptional activator Gal4p, a negative regulator Gal80p ... Gal3p A fundamental question arises with regards tothe mechanism for transmission ofthe galactose signal from the cytoplasm tothe DNA–Gal4p–Gal80p complex present in the nucleus to activate...
... 1998 the ISO (International Organization for Standardization) approved a standard for C++ (ISO/IEC 14882) ᮀ Characteristics of C++ C++ is not a purely object-oriented language but a hybrid that ... from the C programming language: ++ isthe increment operator in C As early as 1989 an ANSI Committee (American National Standards Institute) was founded to standardize the C++ programming language ... contains the functionality ofthe C programming language This means that you have all the features that are available in C: ■ ■ ■ universally usable modular programs efficient, close tothe machine...
... integral points on the parametrization that arises out ofthe passage tothe universal torsor, as discussed above In the proofs of Theorems 1–4 the torsor equations all take the shape Aj + Bj ... equivariant compactification of G2 Salberger has raised athe question of whether there exist singular del Pezzo surfaces of degree that arise as equivariant compactifications of Ga × Gm , but that ... equivariant compactification of G2 in the proof of Theorem 2, and this renders the method applicable to other a surfaces in the list that are not of this type For example, in further work de la Bret`che...
... commodity teams' efforts to prepare the agenda and data for the actual negotiation team The mandate team must have the authority and responsibility, which actually meansa charter and resources ... time the purchasing department is just starting to evolve from reactive to proactive status Any major organizational change is traumatic to individuals accustomed to either status quo or ''having ... prepares the RFP The purchasing manager will have to relinquish total power and authority and learn to accept the team decisions, not an easy behavior change for the autocratic manager Competent Team...
... political actors is central to another ofthe other major theories of policy-making often improperly construed as antithetical tothe MSF, namely the Advocacy Coalition Framework (ACF) As is well ... with other political actors and little conceptual work has attempted to move beyond early formulation and take such factors into account in their analysis This idea of at least three distinct ... collaborate in the formation of policy alternatives and constitute an often “hidden cluster” of actors More visible actors in the politics stream can include, for example in the case ofthe US...
... suggested that after an item enters the formal agenda, that at least some ofthe streams split off once again to resume their parallel courses (Teisman 2000, Zahariadis 20 07) And yet others have suggested ... sequences of events which impact actors existing outside of them, rather than integrating actors into the very heart ofa these events In these models streams of events flow and interact with each other ... experts who collaborate in the formation of policy alternatives, and constitute an often “hidden cluster” of actors dealing with alternative specification, according to Kingdon Visible actors of the...
... CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG Ccttctccccggcggttagtgctgagagtgc ... Ccttctccccggcggttagtgctgagagtgc aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa Primer with NcoI site Sense ARS with PstI and SalI Antisense ARS with PstI and SalI TOP ARS Acknowledgements This work was ... Transcription start site C β-gal (2) ARS-β-gal CMV Transcription start site β-gal AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa -3 (3) TOP-β-gal CMV Transcription start site β-gal...
... Komaru et al Novel aggregate formation of an alkaline phosphatase frame-shift mutant Hypophosphatasia is an inborn error of metabolism characterized by defective mineralization of hard tissues and ... T, Yamamoto T, Yasui N, Satomura K, Yamagata M, Shima M, Nakajima S, Mushiake S, Okada S & Ozono K (1998) Analysis of localization of mutated tissue-nonspecific alkaline phosphatase proteins associated ... fraction was collected from the top ofthe gradient and assayed for alkaline phosphatase activity (ordinate, unit per mL fraction) BSA (b, 68 kDa), alcohol dehydrogenase (a, 141 kDa) and catalase (c,...
... tRNA1 -1 has a single TATA element at ) 130 bp and is transcribed tothe same levels as the parent pmutRKX3 has the single TATATAA element of Gly pRKX3 mutated to GATATCA tRNA1 -6 ,7 (in plasmid Gly ... sequestration ofthe basal transcription factor TFIIIB, as well as the formation of unstable transcription complexes In Drosophila, a transcription factor TRF, rather than TBP, has been reported to ... Ni-NTA-affinity matrix [ 43] Nuclear extract preparation and fractionation ofthe B mori transcription machinery Nuclear extracts from the PSG of B mori in the fifth larval instar (day 2) were prepared...
... due tothe poor quality ofthe maps, and refinement with refmac5 [29] stalled at R-factors of 26 and 30 % This may be due to real disorder in the crystal as the mean B-factor from the refinement was ... 200–2 07 and 2 13 226) The otherwise compact structure is FEBS Journal 274 (20 07) 31 28 31 37 ª 20 07The Authors Journal compilation ª 20 07 FEBS 31 29 Structure of S agalactiae STP A M K Rantanen et al ... 31 28 31 37 ª 20 07The Authors Journal compilation ª 20 07 FEBS 31 35 Structure of S agalactiae STP M K Rantanen et al Table Structure refinement statistics for SaSTP against the native ˚ P21212 and SAD...
... factor [ 13] Additionally, two other transcription factors have been shown to play a significant role in mitochondrial biogenesis, the nuclear respiratory factors (NRFs) and [5,14] These factors ... luciferase activity ofthe vector with no insert was defined as being equal to one Luciferase activity was normalized tothe b-galactosidase activity of cotransfected control plasmid Values are themeans ... plasmid pSV-bGAL and the quantification of luciferase was normalized to b-galactosidase activity Luciferase activity was determined using the Luciferase Assay System (Promega) according to manufacturer’s...