molecular imaging is a relatively new field that aims at the visualization and follow up of cellular dysfuncti
báo cáo khoa học:" A ‘short walk’ is longer before radiotherapy than afterwards: a qualitative study questioning the baseline and follow-up design" potx
... prior to cancer diagnosis and treatment as standard of comparison, whereas at follow- up he compared his current fatigue with his level of fatigue during the first weeks of radiotherapy: Example Were ... strategy and combinatory algorithm to reprioritization (a change in individual’s values), and change in standards of comparison to recalibration (a change in individual’s internal standards) Although ... processes) as our unit of analysis, rather than the individual patient The cognitive processes underlying QoL appraisal were saturated at an early stage of data collection However, to include a heterogeneous...
- 12
- 230
- 0
Báo cáo y học: "High-molecular-weight hyaluronan – a possible new treatment for sepsis-induced lung injury: a preclinical study in mechanically ventilated rats" ppsx
... protein and DNA contamination found in the LMW HA that is proinflammatory, and not the LMW HA itself [10,36] One explanation of the lack of proinflammatory effects of the HA used in this study is the ... secondary to an increase in the ratio of HMW HA to LMW HA – thereby maintaining the level of HMW HA in the extracellular matrix and maintaining the integrity of the extracellular matrix [4], and preventing ... may have been secondary to an increase in the ratio of HMW HA to LMW HA, thereby maintaining the level of HMW HA in the extracellular matrix and maintaining the integrity of the extracellular...
- 11
- 297
- 0
Báo cáo khoa học: Plant DNA polymerase k, a DNA repair enzyme that functions in plant meristematic and meiotic tissues docx
... autoradiography DNA substrate used in this assay is a d15:d21-mer primer/ template The sequences are 5¢-ACTGGAGATCTGC AT- 3¢ and 5¢-TGAAGCATGCAGATCTCCAGT-3¢ Misincorporation assay The four template/primer ... single-stranded 75-mer (3¢-OH ends) The sequence of 75-mer oligonucleotide is 5¢-AGCTACCATGCCT GCACGAAGAGTGCGTATTATGCCTACACTGGA GTACCGGAGCATCGTCGTGACTGGGAAAAC-3¢ [3H]dTTP (10 lM; 10 CiÆmmol)1) and ... in Materials and Methods, the AP site-containing strand was 3¢-end-labeled with [a- 32P]ddATP, annealed to its complementary strand and treated with human AP endonuclease to release a dRP-containing...
- 9
- 492
- 0
Social Impact Bonds - A promising new financing model to accelerate social innovation and improve government performance pot
... programs refine their models, prove effectiveness at a pilot location, demonstrate that the model can be replicated, and then try to attract the attention of policymakers, is slow The Maternal, ... entity that must emerge is the social impact bondissuing organization that will have to raise capital from private investors, negotiate performance-based contracts with the government, and hire and ... now be assessed on an ongoing basis using government administrative data records Using these data systems can avoid much of the cost and attrition bias that arises when outcomes are measured...
- 36
- 421
- 0
báo cáo hóa học:" Use of Tranexamic acid is a cost effective method in preventing blood loss during and after total knee replacement" ppt
... supervision, preparation of the questionnaire and collection and analysis of data TA was involved in the study design, analysis and was involved in critically reviewing the manuscript FA and MUC participated ... participated in the designed the Page of study and participated in the preparation of the protocol and data collection MU participated in overall supervision and critically reviewed the manuscript All ... important factors that Table Different methods of blood conservation and their complications Alternatives used to avoid allogenic blood transfusions and their disadvantages • Cardiac, Vasovagal (Risk...
- 5
- 447
- 0
báo cáo hóa học:" Use of Tranexamic acid is a cost effective method in preventing blood loss during and after total knee replacement" pdf
... supervision, preparation of the questionnaire and collection and analysis of data TA was involved in the study design, analysis and was involved in critically reviewing the manuscript FA and MUC participated ... participated in the designed the Page of study and participated in the preparation of the protocol and data collection MU participated in overall supervision and critically reviewed the manuscript All ... important factors that Table Different methods of blood conservation and their complications Alternatives used to avoid allogenic blood transfusions and their disadvantages • Cardiac, Vasovagal (Risk...
- 5
- 409
- 0
Báo cáo hóa học: " Research Article A New Approximation Method for Solving Variational Inequalities and Fixed Points of Nonexpansive Mappings" docx
... PHD/0018/2550 and the Graduate School, Chiang Mai University, Thailand References A Moudafi, “Viscosity approximation methods for fixed-points problems,” Journal of Mathematical Analysis and Applications, ... Xu, “Viscosity approximation methods for nonexpansive mappings,” Journal of Mathematical Analysis and Applications, vol 298, no 1, pp 279–291, 2004 G Marino and H K Xu, A general iterative method ... nonexpansive mappings in Hilbert spaces,” Journal of Mathematical Analysis and Applications, vol 318, no 1, pp 43–52, 2006 H Iiduka and W Takahashi, “Strong convergence theorems for nonexpansive mappings...
- 16
- 268
- 0
Báo cáo y học: "Pro-atrial natriuretic peptide is a prognostic marker in sepsis, similar to the APACHE II score: an observational study" pptx
... quantitative sandwich enzyme immunoassay (Pelikine Compact™; CLB, Amsterdam, The Netherlands), with a limit of detection at 0.6 ng/l Statistical analysis Data in the text are expressed as mean ± standard ... admission, day 2, day of discharge and death) are displayed Solid lines denote median values, boxes represent 25th to 75th percentiles and whiskers indicate the range ANOVA, analysis of variance ... 19 aOne patient can have more than one diagnosis, and so the total exceeds the absolute number of patients (n = 101) elsewhere [20] As a modification to the published assay, the calibration was...
- 9
- 254
- 0
A STUDY ON FACTORS THAT AFFECT ON THE FIXED BED GASIFICATION PROCESS NGHIÊN cứu một số yếu tố ẢNH HƯỞNG đến QUÁ TRÌNH KHÍ hóa TRẤU TẦNG cố ĐỊNH
... so in the gasification system, the moisture of the fuel is a vital parameter Relative humidity of the material is as the ratio between the amount of moisture contained in the material and the volume ... volume of material - Heat total value Qh [Kcal]: Heat total of husk is calculated basing on the weight of consumed husk mh [kg] and the heat value per each mass unit of the husk qh[Kcal/kg] as shown ... equipment was unable to operate and the gasification could not take place Obviously, it was the large amount of water stored inside the input fuel prevented the flame of gasification Although the lower...
- 6
- 298
- 0
Tài liệu The Economic and Social Effects of Financial Liberalization: A Primer for Developing Countries pptx
... tài quan điểm Thông tin bất cân xứng cấu trúc tài Khung hoảng tài Khủng hoang tai 4/1/2009 Copyright © 2000 Addison Wesley Longman Slide #14-2 1.Cau trúc tai Cấu truc tài 2.Các quan điểm l a chon ... Slide #14-17 Corporate bond Commercial paper C i l Nguồn tài trợ Mỹ 1970-1985 Government loans loans b f i l by foreigners Trade debt Copyright © 2000 Addison Wesley Longman Slide #14-18 Nguồn ... tích cực vay nợ (kết nghịch) => rủi ro tín dụng cao => người cho vay phản ứng nghịch khơng cho vay, kể người có rủi ro thấp thấp Rủi ro đạo đức (Moral Hazard): Xảy sau giao dịch Người vay có động...
- 31
- 463
- 0
Báo cáo " A web-based decision support system for the evaluation and strategic planning using ISO 9000 factors in higher education " pot
... and plan for a strategy in educational management of organizations in Vietnam and Asia [3] However, there are no DSS applications to apply a real case in the domain of an evaluation and a strategic ... evaluation and a strategic university planning For the implementation, a Web-based DSS is based on ISO 9000 factors for the evaluation and strategic planning for a case study of Vietnam National ... study applied Web-based DSS application for an evaluation and a strategic planning of educational management in Vietnam This study has contributed in effective evaluation for educational management...
- 12
- 541
- 0
A RIP VAN WINKLE OF THE KALAHARI AND OTHER TALES OF SOUTH-WEST AFRICA doc
... borderland between Klein Namaqualand, and Gordonia, Cape Colony, and what was at that time known as German South- West Africa Four of them appeared a few years back in The State an illustrated magazine ... life, and the sad conviction was forced upon me that Inyati had perished, and that I was alone CHAPTER IV THE PANS AND THE POISON FLOWERS By this time the sun was high in the heavens, and I realized ... on the fat of the land Game there was in abundance, so much so, indeed, that they were a cause of anxiety, for the water in the vlei was decreasing rapidly from the number of animals that drank...
- 160
- 619
- 1
The Costs and Financial Benefits of Green Buildings: A Report to California’s Sustainable Building Task Force pptx
... well as benefits rise at the rate of inflation – and so present value calculations are made on the basis of a conservative real 5% discount rate absent any inflation effects In reality, this is ... Portland; San Mateo County; the University of California; the Department of the Navy; the federal General Services Administration; and the states of Oregon, New York and Maryland have all adopted ... http://www.athenasmi.ca/ 63 Clearview Elementary School Athena Model Output, 7Group Available at: http://www.sevengroup.com/pdf/Athena.PDF 64 The Athena Sustainable Materials Institute Members Newsletter...
- 134
- 772
- 0
WHY IT IS SO HARD TO GET SAFE WATER TO THE POOR – AND SO PROFITABLE TO SELL IT TO THE RICH pdf
... of use water and storage devices 30 The real advantage of HWTS is that they can ensure safe water at the crucial point, the point of use,' and not at the point where the water is treated or collected ... indicate that the best case scenario may be realised Cost and Returns : It is estimated that the realisation of the plan would cost US$ million over five years for the facilitation and market creation ... understandable that the dissemination strategy was – at least in the beginning – very focused on rational arguments around the methodology of reducing pathogens through heat and UV radiation Later the...
- 120
- 467
- 0
International consensus recommendations on the aesthetic usage of botulinum toxin type A (Speywood Unit) – part II: wrinkles on the middle and lower face, neck and chest pdf
... BoNT -A treatment in ´ ´ the decollete area Anatomy The major muscles in the chest area are the caudal part of the platysma and the medial fibres of the pectoralis major The injector can palpate the ... more appropriate Anatomy The orbicularis oculi is usually divided into the lacrimal, palpebral and orbital portions The lacrimal portion is at the medial side of the orbit, and is the smallest and ... to the wrinkles on the lateral part of the nose In some patients, the wrinkles also exist on the dorsal part of the the procerus, the nasalis and the depressor septi nasi The nasalis is the main...
- 11
- 772
- 1
Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc
... orientation as in (A) and (D) (H) The top view of a van der Waals sphere representation of RIIa D/D The orientation of this view is the same as in (B) and (E) (I) The bottom view of a van der Waals ... observation supports the hypothesis that noncovalent interactions are sufficient to maintain dimerization In RIIa there are no disulfide bonds at the dimer interface, as is the case for the RI isoforms ... free catalytic subunit), upon cAMP binding in the regulatory subunit It is possible that in the activated form of the regulatory subunit, the charges of the C-terminal face of RIIa D/D participate...
- 12
- 536
- 0
Molecular dynamics simulations of the tensile and melting behaviours of silicon nanowires
... simulations of silicon nanowires of various shapes and orientations Menon [20] and Ponomareva et al [22] investigated the tetragonal and clathrate SiNWs Based on the reported experimental observation ... demonstrate that the critical buckling load decreases at higher temperature At higher temperature, the atomic structure has high entropy, and the atoms vibrate about their equilibrium position at ... SiNWs are initially annealed at 700 K over a period of 106 time-steps, where each step is separated by an interval of 0.5 fs, and then the structures of the nanowires were dynamically relaxed at a...
- 5
- 456
- 0
Báo cáo khoa học: Effects of cardiomyopathic mutations on the biochemical and biophysical properties of the human a-tropomyosin docx
... of functionality that accumulates over time This hypothesis supports the fact that the mutation that causes the greatest loss in stability also causes FHC pathology at the youngest age [11] Acknowledgements ... recombinant human Tm produced in P pastoris, to investigate the effects of cardiomyopathic-related mutations on the human skeletal Tm Our data indicate that the main effects of mutations A6 3V, K70T and ... [22] The oligonucleotides AOX-F (5¢-GCGACTGGTTCCAATTGAC-3¢), AOX-R (5¢-GG TCTTCTCGTAAGTGCCC-3¢), SKTM -A6 3V (5¢-GAC AAATACTCTGAAGTACTCAAAGATGCCCAG-3¢), SK TM-1R (5¢-CTGGGCATCTTTGAGTACTTCAGAGTA TTGTC-3¢),...
- 9
- 603
- 0
The special and general theory of relativity a einstein
... Lorentz transformations This is a definite mathematical condition that the theory of relativity demands of a natural law, and in virtue of this, the theory 36 becomes a valuable heuristic aid in the ... XIX The Gravitational Field XX The Equality of Inertial and Gravitational Mass as an Argument for the General Postulate of Relativity XXI In what Respects are the Foundations of Classical Mechanics ... of co-ordinates of which the state of motion is such that the law of inertia holds relative to it is called a “Galileian system of coordinates.” The laws of the mechanics of Galilei-Newton can...
- 152
- 414
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose