0

ii any filings on behalf of owners and operators of a nox budget unit or nox budget source shall be signed by the nox authorized account representative any filing on behalf of persons with an ownership interest with respect to nox allowances in a

A Proposed International Accounting Standard Reporting Turnover and Tax by Location A proposal by Richard Murphy BSc FCA on behalf of the Association for Accountancy and Business Affairs pptx

A Proposed International Accounting Standard Reporting Turnover and Tax by Location A proposal by Richard Murphy BSc FCA on behalf of the Association for Accountancy and Business Affairs pptx

Kế toán - Kiểm toán

... true and fair view of the financial position and profit or loss of a reporting entity Reporting entity means any enterprise within the scope of International Accounting Standards For sake of example ... public awareness of the workings, the social, political and the economic role of accountancy and business organisations AABA’s patron is the Rt Hon The Lord Paul of Marylebone AABA trustees are Professor ... Companies themselves will be able to demonstrate the ethical stance they are taking on trading and taxation matters A Proposed International Accounting Standard - Reporting Turnover and Tax by...
  • 22
  • 648
  • 0
Financial Audit Services: On behalf of the Comptroller and Auditor General and the Northern Ireland Audit Office Invitation to Tender potx

Financial Audit Services: On behalf of the Comptroller and Auditor General and the Northern Ireland Audit Office Invitation to Tender potx

Kế toán - Kiểm toán

... are being let in four lots 2.2 The assignments comprise financial audits conducted in accordance with International Standards on Auditing (UK and Ireland) issued by the Auditing Practices Board ... Information Questionnaire at Appendix and the Freedom of Information Statement at Appendix The NIAO Standard Terms and Conditions applicable to the Contracts are attached at Appendix Tenderers must accept ... corporate governance framework in the public sector; Audit Assignments may require attendance at a number of locations within each organisation, and tenderers must confirm they are capable of...
  • 6
  • 270
  • 0
báo cáo hóa học:

báo cáo hóa học: " Recruitment and retention of farm owners and workers for a six-month prospective injury study in New Zealand: a feasibility study" pdf

Hóa học - Dầu khí

... in the Waitaki TLA was obtained from the AgriBase™ database, a national database of farm ownership, location and management in New Zealand owned and maintained by AgriQuality AgriQuality is a ... farms and farm workers within the Waitaki TLA Farms had to be at least 30 hectares in size and contactable by phone (either land-line or cellular), as much of the study contact was conducted by ... conception and design of the study, supervised the data collection and analyses and commented on manuscript drafts All authors have read and approved the final manuscript Competing interests The...
  • 10
  • 397
  • 0
Báo cáo khoa học: Purification and cloning of a Delta class glutathione S-transferase displaying high peroxidase activity isolated from the German cockroach Blattella germanica pptx

Báo cáo khoa học: Purification and cloning of a Delta class glutathione S-transferase displaying high peroxidase activity isolated from the German cockroach Blattella germanica pptx

Báo cáo khoa học

... of at least six classes of cytosolic GSTs in insects [2] The majority of GSTs are in the Delta and Epsilon classes, and the remaining enzymes are in the Omega, Sigma, Theta and Zeta classes The ... Gene name GenBank accession number Drosophila melanogaster Nilaparvata lugens Lucilia cuprina Anopheles dirus Bombyx mori Manduca sexta Anopheles gambiae Anopheles gambiae Blattella germanica Drosophila ... 23 Ranson H, Prapanthadara L -A & Hemingway J (1997) Cloning and characterization of two glutathione S-transferases from a DDT-resistant strain of Anopheles gambiae Biochem J 324, 97–102 24 Toung...
  • 11
  • 426
  • 0
Upgrading IBM Systems Director Server on Windows and migrating to a Microsoft SQL Server or Microsoft SQL Server Express database Version 6 Release 3 pptx

Upgrading IBM Systems Director Server on Windows and migrating to a Microsoft SQL Server or Microsoft SQL Server Express database Version 6 Release 3 pptx

Cao đẳng - Đại học

... cfgdbcmd command runs v When you back up and restore the database by using the smsave command and the smrestore command, you enter the user ID and password of the database system administrator as follows: ... DB2 database Related tasks: Removing a resource Discovering systems and collecting inventory data Related information: IBM Storage Configuration Manager Planning, Installation, and Configuration ... from one database type to another at any time When you switch your database to the default managed IBM DB2 database, you can migrate your database data to the managed IBM DB2 database Upgrading and...
  • 66
  • 600
  • 0
báo cáo hóa học:

báo cáo hóa học: " Educators'''' working conditions in a day care centre on ownership of a non-profit organization" pot

Hóa học - Dầu khí

... Educators’ working conditions in a day care centre on ownership of a non-profit organization Bianca Kusma* 1, 2, Stefanie Mache 1,3, David Quarcoo 1, Albert Nienhaus and David A Groneberg1 1Institute ... was sent to the management of a randomly selected day care centre on ownership of a non-profit organization in Berlin After receiving departmental approval, educators were invited to participate ... contact Walking Cleansing of rooms and toys, plants and animal husbandry Attendance at continuing education, supervision of work Settle a dispute, console a child, welcoming of a child, individual...
  • 22
  • 257
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article On Stability of a Functional Equation Connected with the Reynolds Opera" docx

Báo cáo khoa học

... Differential Equations and Their Applications, Birkh¨ user Boston, a Boston, Mass, USA, 1998 [2] J Acz´ l and J Dhombres, Functional Equations in Several Variables, vol 31 of Encyclopedia of e Mathematics ... Semrl, The stability of the exponential equation,” Proceedings of the American Mathematical Society, vol 124, no 3, pp 779–787, 1996 [6] J A Baker, J Lawrence, and F Zorzitto, The stability of the ... C ∗ -algebra Ꮾ and a continuous monomorphism Λ of Ꮽ into Ꮾ such that Ꮾ is represented as a direct sum Ꮾ = I ⊕ J where I and J are closed ideals and PΛ f is exponential, and QΛ f is norm-bounded...
  • 3
  • 216
  • 0
Alexander skutin, on rotation of a isogonal point

Alexander skutin, on rotation of a isogonal point

Toán học

... need to prove that locus of points P is a circle It is clear that the transformation which maps H to P is a composition of an inversion, a parallel transform and rotations Indeed, denote by zx the ... this transformation is a circle Author is grateful to Alexey Pakharev for help in preparation of this text References [1] A V Akopyan Rotation of isogonal point Journal of classical geometry:74, ... coordinate of a point X in the complex plane Than this transformation have the following equation: zq − z p zh → zq + (zh − zq ) zh − z p Therefore, the image of the circle ω under this transformation...
  • 2
  • 362
  • 0
báo cáo khoa học:

báo cáo khoa học: " Recovery and characterization of a Citrus clementina Hort. ex Tan. ''''Clemenules'''' haploid plant selected to establish the reference whole Citrus genome sequence" pot

Báo cáo khoa học

... [5-7] and for the integration of genetic and physical maps [8], thereby permitting high precision analyses of the relationship between megabases and centimorgans and, thus, increasing the precision ... plant C.1 and the aneuploid plant B.1 were analysed with an additional 47 SSR markers to confirm their genetic structure (Table 2) 'Fortune'mandarin is a hybrid of clementine and 'Dancy' mandarin ... point of view Haploid and double haploid plants, together with the original diploid plant and autotetraploid plants obtained in our laboratory [63] are excellent material to carry out pioneering...
  • 17
  • 196
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Application of a haematopoetic progenitor cell-targeted adeno-associated viral (AAV) vector established by selection of an AAV random peptide library on a leukaemia cell line" pot

Báo cáo khoa học

... CMLaand CD34rAAV2-based GFP+ cells) using Figure of and standard + rAAV capsid mutant an MOI Gene transfer efficiency of the rAAV capsid mutant (EARVRPP; ) and a standard rAAV2-based vector (ᮀ) on ... the rAAV capsid mutants and control vectors on a panel of leukaemia cell lines (in % GFP+ cells) Gene transfer efficiency of the rAAV capsid mutants and control vectors on a panel of leukaemia cell ... without prior appearance Using the rAAV capsid mutant clones on a panel of leukaemia cell lines, an over 2-fold increase in gene transfer over standard rAAV2-based vectors could be obtained on...
  • 9
  • 328
  • 0
A Note on Power of a Point

A Note on Power of a Point

Toán học

... inversion first Problem (APMO 2010) Let ABC be an acute angled triangle satisfying the conditions AB > BC and AC > BC Denote by O and H the circumcenter and orthocenter, respectively, of the triangle ... points and let O1 be the circumcenter of A B C Recall that the circumcircles of triangles ABH, BCH, CAH all have equal radii as they are reflections of the circumcircle of ABC over the triangle’s ... Thus their images are lines that all have the same distance from H So H is the incenter of A B C (that’s the key!) We construct point M as the intersection of A C and the circumcircle of A B H As...
  • 5
  • 314
  • 0
A numerical study on flapping of a flexible foil

A numerical study on flapping of a flexible foil

Cao đẳng - Đại học

... regions spanned by ¯ the nondimensional time t and Lagrangian abscissa s Points denote transitions from one regime to another in our simulations (I) , (II) and (III) correspond to the uniformly ... between the plate tangent and the horizontal line, as shown in Figure 3.1, and α(s) is the local orientation rate ˙ Here, xs and ys are the local Euclidean coordinates attached to the point with ... Boundary layer and vortex shedding behind the foil with the description of the coordinate system attached to the structure Here, s denotes the Lagrangian coordinate and α is the orientation angle...
  • 100
  • 497
  • 0
A preliminary research on development of a fibre composite, curved FDM system

A preliminary research on development of a fibre composite, curved FDM system

Tổng hợp

... Proceedings of the International Conference on Manufacturing Automation, Singapore, 2007 Ian Gibson, Savalani Monica Mahesh, Muhammad Tarik Arafat and Liu Yuan, The use of multiple materials in Rapid ... Muhammad Tarik Arafat for encourage and discussion in study I would also like to thank Advanced Manufacturing Laboratory (AML) and Laboratory for Concurrent Engineering and Logistics (LCEL) for ... prototyping, tooling and manufacturing (RP, RT and RM) techniques One of the advantages of SLS is flexibility in the range of material that can be used, and therefore many research organizations have developed...
  • 96
  • 429
  • 0
Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt

Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt

Báo cáo khoa học

... (A) Surface and total protein were isolated by biotinylation and analyzed by western blot Using Cx43 and GFP antibodies to conrm proper translation of Cx43eYFP constructs, bands of approximately ... degradation between WT and the Y28 6A mutant but not between WT and any of the other mutants We expected to see a greater difference between WT and Y28 6A given that assay of the Y28 6A mutant in ... following mutagenic forward primers were used: Y28 6A, 5Â-GATCA TGAATTGTTTCTGTCGCCAGTAACCAGCTTGGCCC CAGGAGGAGACATAGGCG-3Â; LSYTRF, 5Â-GCAAG AAGAATTGTTTCTGTCGCCAGTGAACCGGGTATAT GACAAAGGAGACATAGGCGAGAGGGGAGC-3Â...
  • 14
  • 433
  • 0
Intra-articular injection of a nutritive mixture solution protects articular cartilage from osteoarthritic progression induced by anterior cruciate ligament transection in mature rabbits: a randomized controlled trial ppsx

Intra-articular injection of a nutritive mixture solution protects articular cartilage from osteoarthritic progression induced by anterior cruciate ligament transection in mature rabbits: a randomized controlled trial ppsx

Báo cáo khoa học

... radial zone, swelling or disappearance of chondrocytes in the tangential zone, moderate to severe cloning in the transitional and radial zones and slight pannus formation, as compared with the Normal ... glutamate, alanine, aspartate, serine, glutamine, arginine, lysine and methionine Cysteine and ascorbic acid were added as cofactors that promote the synthesis of type II collagen in articular cartilage ... performed histopathological examinations, interpreted the data, and reviewed the manuscript JSH and JSK participated in the study design, animal handling and care, and reviewed the manuscript All...
  • 9
  • 253
  • 0
Báo cáo y học:

Báo cáo y học: "Insights into spatial configuration of a galactosylated epitope required to trigger arthritogenic T-cell receptors specific for the sugar moiety" ppsx

Báo cáo khoa học

... Drs Orly Amar and Alexandra Doncarli for help with the initiation of the study They greatly acknowledge the expert assistance of Franck Lager for breeding and husbandry of the mice, and Page of ... data analysis; she was responsible for study design coordination and the writing of the manuscript, and interpretation and discussion of the data GC was responsible for most of the data analysis; ... hybridomas A2 G10, A9 E5 and A8 E2, and clone A9 .2 to several CII256–270 analogues T cells were stimulated with increasing A2 G10, A9 E5 and A8 E2, and clone A9 .2 to several CII256–270 analogues concentrations...
  • 9
  • 318
  • 0
báo cáo khoa học:

báo cáo khoa học: "Successful treatment of a T4 lung tumor with vertebral body invasion using fiducial markers in the thoracic spine for image-guided radiation therapy: A case report" pps

Báo cáo khoa học

... tomographic scan Page of concurrent carboplatin and paclitaxel, followed by consolidation carboplatin and paclitaxel He was evaluated by an orthopedic surgeon (JH) for implantation of fiducial ... megavoltage (MV) images and allow for matching of patient anatomy to bony landmarks on a DRR Yin et al [8] at Henry Ford Hospital have used KV X-ray imaging with anatomy matching to vertebral bodies ... fractionated radiation therapy Patients who have spinal or paraspinal tumors who are not candidates for radiosurgery because of tumor factors such as large tumor size or other clinical reasons (such...
  • 5
  • 279
  • 0
Báo cáo y học:

Báo cáo y học: "Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease" pptx

Báo cáo khoa học

... cellular assays and analysis and interpretation of data, EJM, MW and CL participated in the design of the study and analysis and interpretation of data HB conceived of the study, participated in ... design and coordination and helped to draft the manuscript All authors read and approved the final manuscript Competing interests All authors are or were employed in a full-time capacity by Pfizer ... clinical translation is vital in the search for new treatments for disease A number of different animal models have been used to study RSV infection and replication and to evaluate potential therapies,...
  • 11
  • 348
  • 0
Báo cáo y học:

Báo cáo y học: "Health status in COPD cannot be measured by the St George’s Respiratory Questionnaire alone: an evaluation of the underlying concepts of this questionnaire" ppt

Báo cáo khoa học

... the acquisition of the data, performed statistical analyses and interpreted the data, and drafted the manuscript JBPe participated in the acquisition of the data, and in the critical revision of ... Table for definitions of the subdomains and corresponding instruments Statistical Analyses The relationships between the sections of the SGRQ and the sub-domains of the NIAF, as well as the intercorrelations ... manuscript for important intellectual content JHV conceived the study, participated in its design and coordination and helped to draft the manuscript All authors read and approved the final manuscript...
  • 7
  • 366
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Fertility of frozen-thawed stallion semen cannot be predicted by the currently used laboratory methods" ppt

Báo cáo khoa học

... numbers and concentration The total number of sperm/AI dose and concentration correlated negatively with many parameters This can be explained by the tendency to increase AI dose and thus the concentration ... straws at 50°C for 40 and the 5-mL straws for 45 sec The semen concentration was measured in a Bürker counting chamber, and the total number of spermatozoa per straw calculated An insemination ... constraints in horse breeding – small numbers of mares per ejaculate and per stallion and the tremendous variations in mare management and insemination – never allow us to carry out trials similar...
  • 8
  • 310
  • 0

Xem thêm