his mouse a model for in vivo testing of lentiviral vector gene delivery into hscs
Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx
... metabolism of the allergen was altered as a result of the in ammation in the lungs of sensitized animals Up to now there are few data available on the fate of an allergen after inhalation In this ... aiming at an understanding of how airborne allergens interact with the airway mucosa and the immune system after inhalation are of crucial importance Mice are used widely for in vivo models of ... the Sel-tag had an intact core sequence and maintained allergen-specific IgE-binding epitopes and the use of a Sel-tag enabled labelling with the gamma-emitting radionuclide 75Se at a single predefined...
- 12
- 518
- 0
Báo cáo y học: " Identification of unique reciprocal and non reciprocal cross packaging relationships between HIV-1, HIV-2 and SIV reveals an efficient SIV/HIV-2 lentiviral vector system with highly favourable features for in vivo testing and clinical usa
... 5'GGAATACCATTTAGTTAAAGATCTGAACAGCTATACTTGGTCAGGG-3' and :5'-CCCTGA CCAAGTATAGCTGTTCAGATCTTTAACTAAATGGTATTC C-3'; for stage 2, downstream mutagenesis, 5'CGCCCTCATATTCTCTGTATAGATCTACCCGCTAGCTTGCATTG-3' and 5'-CAATGCAAGCTAGCGGGTAGATCTATACAGAGAATATGAGGGCG-3' ... and 3' ends of the 141 bp region that was to be deleted Mutagenesis was carried out as in two stages using the following primers: stage 1, upstream mutagenesis:- 5'GGAATACCATTTAGTTAAAGATCTGAACAGCTATACTTGGTCAGGG-3' ... signal may act as a subcellular localisatio signal as well as a high affinity binding site for Gag The resulting RNAprotein complex is then targeted to the plasma membrane where virion budding takes...
- 14
- 437
- 0
Báo cáo y học: " A remission spectroscopy system for in vivo monitoring of hemoglobin oxygen saturation in murine hepatic sinusoids, in early systemic inflammation" doc
... normal saline was administered at a rate of 0.4 ml/hr to maintain normal mean arterial pressure As formerly described [4], and for the realization of the intravital microscopy procedure in anaesthetized ... depicted in Figure Hepatic tissue injury Serum alanine aminotransferase (ALT) and serum aspartate aminotransferase (AST) levels are summarized in Table When compared with sham animals, mice treated ... NR participated in design and coordination and OE participated in animal procedures and in drafting the paper All authors approved and read the final manuscript Acknowledgments This work was supported...
- 8
- 239
- 0
Development of a bioreactor for in vitro engineering of soft tissues
... the chamber maintaining steady state Low inlet gas flow rates were maintained such that inexpensive commercially available CO2, O2, and N2 tanks would last for approximately weeks In this system, ... Table G-1 Alamar Blue reading and % reduction calculation for Day 132 Table G – Alamar Blue reading and % reduction calculation for Day 17 132 xv Chapter Introduction Ligaments and tendons are ... straining, scaffolds from strained and unstrained groups were washed with PBS and then fixed in 4% Formalin for one day The samples were then stained with Haematoxylin & Eosin (H & E) stain using...
- 151
- 253
- 0
Retrovirology Research BioMed Central Open Access In vivo expression of the HBZ gene of HTLV-1 doc
... Murata K, Hayashibara T, Sugahara K, Uemura A, Yamaguchi T, Harasawa H, Hasegawa H, Tsuruda K, Okazaki T, Koji T, Miyanishi T, Yamada Y, Kamihira S: A novel alternative splicing isoform of human ... Kamihira S, Sugahara K, Tsuruda K, Minami S, Uemura A, Akamatsu N, Nagai H, Murata K, Hasegawa H, Hirakata Y, Takasaki Y, Tsukasaki K, Yamada Y: Proviral status of HTLV-1 integrated into the host ... type I infection in Japan and Jamaica Int J Cancer 2008, 1:124(3):614-21 Nakagawa M, Nakahara K, Maruyama Y, Kawabata M, Higuchi I, Kubota H, Izumo S, Arimura K, Osame M: Therapeutic trials in 200...
- 11
- 393
- 0
IN VIVO ANALYSIS OF HUMAN LHX3 GENE REGULATION
... 5'-ggtttaaaatttaattagcaggctcctcggacgggtactctcctcattaaactaagtgt ccc-3', 5'-gggacacttagtttaatgaggagagtacccgtccgaggagcctgctaattaaattttaaacc-3' (“C/EBP” mutation); 5'-ggctcctcttacgcaaactctcctccggcaactaagtgtcccattagttaaagt-3', ... 5'-ggctcctcttacgcaaactctcctccggcaactaagtgtcccattagttaaagt-3', 5'-actttaactaat gggacacttagttgccggaggagagtttgcgtaagaggagcc-3' (ATTA3 mutation); 5'-ctctcctcattaaac 26 taagtgtccccggcgttaaagtgaaacttgatggcggtg-3', 5'-caccgccatcaagtttcactttaacgccggggacactta ... 5'-cattccgaggccgactgagctctgaac-3', R3 enhancer site TAAT/ATTA2: 5'aaggtttaaaatttaattagcaggctcc-3'and 5'-ggagcctgctaattaaattttaaacctt-3', R3 enhancer site TAAT/ATTA2 mutated: 5'-aaggtttaaaatttcggtagcaggctcc-3'and...
- 110
- 282
- 0
Báo cáo hóa học: " Melanoma: A model for testing new agents in combination therapies" doc
... dacarbazine with interferon alpha-2b versus dacarbazine with tamoxifen versus dacarbazine with interferon alpha-2b and tamoxifen in patients with metastatic malignant melanoma: an Eastern Cooperative ... Eggermont AM: Interferon alfa- 2a and interleukin-2 with or without cisplatin in metastatic melanoma: a randomized trial of the European Organization for Research and Treatment of Cancer Melanoma Cooperative ... trial of the treatment of patients with metastatic melanoma using chemotherapy with cisplatin, dacarbazine, and tamoxifen alone or in combination with interleukin-2 and interferon alfa-2b J Clin...
- 7
- 449
- 0
Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx
... Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the p53–p21 pathway ... Anemia Research Fund USA, and funds for research in the field of regenerative medicine through the collaboration agreement between the Conselleria de Sanidad (Generalitat Valenciana) and the Instituto ... viral infections [20] Cancer therapy is a principal goal of the current clinical research on hESCs Recently, regression of metastatic melanoma tumors was achieved by transplantation of adaptive...
- 12
- 550
- 0
War Bonds in the Second World War: A Model for a New Iraq/Afghanistan War Bond? docx
... War Bonds in the Second World War: A Model for a New Iraq/Afghanistan War Bond? Summary The high costs of fighting the wars in Iraq and Afghanistan have rekindled congressional interest in ... time of redemption, or paying federal income taxes as interest accrues Series I bonds are securities that accrue earnings based on both a fixed rate of return and a semiannual inflation rate A single, ... official title of “To authorize the issuance of United States War Bonds to aid in funding of the operations in Iraq and Afghanistan.” All three bills are similar and state that the authorized war...
- 7
- 361
- 0
THE REFORM OF THE SAVINGS BANK SYSTEM IN FRANCE – A MODEL FOR OTHER COUNTRIES? docx
... of the savings bank organization Tripartite (approximately 450 local savings associations, 34 regional savings banks, National Bank of the savings banks) Tripartite (519 local savings banks, 12 ... in France Although not independent institutions, they are invariably attached to the savings bank in the region in which they operate In this way, several savings companies are attached to each ... local savings companies at its disposal since 1999 These are not involved in the financial business but are closely associated with the savings banks in a legal and practical sense The local savings...
- 6
- 436
- 0
báo cáo sinh học:" A model for integrating strategic planning and competence-based curriculum design in establishing a public health programme: the UNC Charlotte experience" doc
... Department of Health Behavior and Administration was charged with administering two existing graduate degree programmes (Master of Science in Health Promotion and Master of Health Administration), ... College of Health and Human Services was perceived as a potential leader in establishing a thriving research base that emphasized population health and health behaviour research while generating ... public health status as a campus priority in Fall 2008, graduation of the first BSPH class in the spring of 2009 and awarding of initial CEPH accreditation as a public health programme in June 2009...
- 10
- 577
- 0
báo cáo hóa học:" In vivo evaluation of a vibration analysis technique for the per-operative monitoring of the fixation of hip prostheses" pdf
... using a CAD-procedure Based upon this adapted geometry, a CNC milling machine then transforms a partially preformed prosthesis stem into the final personalized shape Using this technique a maximum ... custom made for each individual patient, during the operation [27] After reaming of the femoral cavity, a 3D imprint of the cavity is made in the form of a silicone mould This mould is scanned and ... fractures (Figures 5b and 6b) A possible fracture may have been avoided in the case of an abnormal bone structure and a deformed endomedullary canal as the FRF analysis showed an abnormality and...
- 10
- 542
- 0
báo cáo hóa học:" An in vivo evaluation of bone response to three implant surfaces using a rabbit intramedullary rod model" doc
... The coating had a minimum total crystallinity of 65% The minimum HA fraction in the crystalline phase was 90% The average tensile and shear strength of the coating were ≥ 34 MPa and ≥17 MPa respectively ... and de-fatted in 50% mixture of ether and acetone before being placed in 100% alcohol again for 12 hours Methods Implants for intramedullary implantation in rabbit femora were manufactured and sterilized ... New Zealand White rabbits were used in our study After institutional review board approval, rabbits underwent bilateral femoral intramedullary implantation under general anesthesia All animals...
- 8
- 413
- 0
Báo cáo lâm nghiệp: "A two-step mortality model for even-aged stands of Pinus radiata D. Don in Galicia (Northwestern Spain)" doc
... site index, …) that affect the natural mortality process MATERIALS AND METHODS 2.1 Data The data in this study are from a trial network of 130 permanent plots installed in pure and even-aged Pinus ... two inventories, the following stand variables were calculated: basal area, quadratic mean diameter, average height, dominant height, age, stem number per hectare, site index and relative spacing ... mathematical model: consistency, path-invariance and asymptotic limit of stocking approaching zero as age becomes very large Also, for even-aged stands it is reasonable to assume that ingrowth...
- 10
- 283
- 0
Báo cáo khoa học: "Choice of a model for height-growth in maritime pine curves" pps
... 118) state that "one advantage of finding stable parameters lies This transformation is made for this practical reasons but, being univariate, it has essentially no effect on the precision and on ... the dual influence of the shape parameter in this case, which partially explains the high e-correlation For this model, a variable shape parameter between curves will also lead to interpretative ... wellknown advantage of these models is that they can provide an efficient summary of the data via a small number of meaningful parameters, the significance of which does not change with the trials...
- 10
- 280
- 0
Báo cáo y học: "Outcome of crisis intervention for borderline personality disorder and post traumatic stress disorder: a model for modification of the mechanism of disorder in complex post traumatic syndromes" ppsx
... examine for any associations between the demographic variables and the total score of the BPRS, BSI, and Client Observation Scale General linear model (mixed model analysis of variance (ANOVA)) was ... place after treatment and included both a retrospective pretreatment and a follow-up rating Finally, the research staff obtained a list of medications before and after treatment in order to ascertain ... informed consent and testing were initiated and completed between and 24 h from the beginning of treatment (that is, from the subject's examination by a psychiatrist and formulation of a treatment...
- 12
- 477
- 0
Báo cáo khoa học: "Interpreting the variations in xylem sap flux density within the trunk of maritime pine (Pinus pinaster Ait.): application of a model for calculating water flows at tree and stand levels" pdf
... particular individuals in a stand Sap flow data have been used for estimating hourly transpiration and canopy conductances in a range of forest stands [1, 10, 13, 19, 20] The sap flow measurements can ... homogeneous temperature and transpi- a crown ration rate; the resistance and capacitance of each compartment are independent of the flux or water potential of the compartment and remain constant ... density and needle area in a stand to a high degree of accuracy Thus, application of this principle could therefore be questionable in the case of a heterogeneous stand Despite large scatter in the...
- 18
- 406
- 0
Báo cáo y học: "The in vivo expression of actin/salt-resistant hyperactive DNase I inhibits the development of anti-ssDNA and anti-histone autoantibodies in a murine model of systemic lupus erythematosus" ppt
... activity in the samples was calculated based on a standard curve of recombinant bovine DNase I (SigmaAldrich) In addition to the standard assay buffer, optimised to generate maximal DNase activity, inhibitors ... units (AEU) relative to a standard positive sample that was assigned a value of 100 AEU The data are presented as mean ± standard error of the mean Statistics were performed comparing autoantibody ... protein and the level of free G-actin in the circulation at sites of inflammation inhibiting the DNase I activity Our data obtained by a transgenic expression of the mutant protein (ash.DNase I) in...
- 11
- 558
- 0
Báo cáo y học: "Sequencing the genome of the Burmese python (Python molurus bivittatus) as a model for studying extreme adaptations in snakes" ppsx
... contracted in the snake and mammalian lineages We are also interested in analyses that focus on areas of the genome outside of the protein-coding regions Complementing our analysis of protein-coding genes, ... Matsubara K, Tarui H, Toriba M, Yamada K, Nishida-Umehara C, Agata K, Matsuda Y: Evidence for different origin of sex chromosomes in snakes, birds, and mammals and step-wise differentiation of ... data together with other comparative data to estimate genomic characteristics of the ancestral amniote genome Page of (or the ancestral squamate genome) would be fascinating, including estimation...
- 8
- 410
- 0
Báo cáo y học: "Data from necropsy studies and in vitro tissue studies lead to a model for allometric scaling of basal metabolic rate" pot
... estimated as the midpoint of the values of ki plus the midpoint of the values of bi because values of ki are not available for certain tissues For scaling of the brain and the epithelial tissues of ... 399:130-132 Banavar JR, Damuth J, Maritan A, Rinaldo A: Supply-demand balance and metabolic scaling Proc Natl Acad Sci USA 2002, 99:10506-10509 Darveau C -A, Suarez RK, Andrews RD, Hochachka PW: Allometric ... multiple data points for a species were replaced by a single data point calculated as the average value of body weight and the average value of BMR for the species The MLE and 95% CI for the scaling...
- 8
- 356
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25