gonorrhoeae mimics human paragloboside and serves as a ligand to the asialoglycoprotein receptor
Access to Finance and Markets as a Strategy to Address Poverty
... IFMR and Diviya Wahi, Shilpa Deshpande, and Anant Natu from ICICI Bank is gratefully acknowledged References Ananth, Bindu, Bastavee Barooah, Rupalee Ruchismita and Aparna Bhatnagar 2004 A Blueprint ... I N G PA R AG R A P H S it has been argued that there exist a set of market-based approaches that have the potential to address poverty on a scaled basis At the heart of this approach is building ... ASPs enables micro-banking operations to enjoy the same transaction quality and cost as is the case with a large bank Launch of MicroFinanceJobs.com to provide access to human resources to these...
- 4
- 267
- 0
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"
... pigs and humans Some of these human and avian influenza viruses might become adapted to pigs and circulate in that population The cocirculation of the viruses in swine, avian and human populations ... infected fowls as demonstrated by the government of China, Vietnam, and Thailand As human populations continue to increase and interactions between animals and humans become more proximate, the emergence ... of the American Medical Association Influenza was not a reportable disease: the only evidence of the early occurrence was the registration of deaths reported as uncomplicated cases of pneumonia...
- 4
- 520
- 0
The Lady and Sada San A Sequel to The Lady of the Decoration potx
... thought, and try to be near if danger, whose name is Uncle, 12 The Lady and Sada San threatens the girl who has walked into my affections and made herself at home 13 The Lady and Sada San Later All the ... royal ranks and rights, for a nurse’s dress and kit Apparently delicate and shy they can be, if emergency demands, as grim as war or as tender as heaven It was a blithesome day and if it had ... little gaieties with me Their lives together had about as much real comradeship as a small brown hen and a big gray owl, 25 The Lady and Sada San and they had been married sixty years! They had toiled...
- 100
- 442
- 0
Báo cáo khoa học: " Taxonomical impact of morphological variation in Quercus robur and Q petraea: a contribution to the hybrid controversy" pps
... see Aas, 1988) Oaks chosen from 30 different stands in and Poland (stands of pedunculate oak, sessile oak and mixed stands; the number of specimen trees per stand varied between and 20) The majority ... into two large (1 and 2) and one small group (3) (fig 1).In table I, the mean values are indicated for each of the groups, and the F-values of the variance-analytical comparison of groups and (Welch-Test, ... considered are suitable for a clear dis- tinction A characteristic regarded as intermediate can always be assigned to at least one of the species and is thus not sufficient proof for hybrid origin The...
- 7
- 287
- 0
Convertible debt under asymmetric information and agency problems, a solution to the convertible debt puzzle
... These figures are similar to those in Datta, Iskandar-Datta, and Raman (2003) and Spies and Affleck-Graves (1995) Panel A of Table reports summary statistics of firm’s characteristics as of the ... amount of assets under their control as long as the value for shareholders is monotonically weakly related to the value of the assets of the firm I claim that there exists a Bayesian Separating Equilibrium ... negative abnormal returns In the former case managers will use cash to pay out bondholders, reducing the available resources at their disposal In the latter case managers can eliminate debt (and...
- 124
- 294
- 0
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt
... oxidation was due to the a chains and the slow phase was due to the b chains Tsuruga et al found that the beta chain of the tetramer does not exhibit any proton-catalyzed auto-oxidation [22] These ... several studies Mansouri and Winterhalter [5] reported that the oxidation of the a chains of Hb A0 was 10 times faster than that of the beta chains and that the oxidation of the beta chains was ... coli was a lag phase of 10 minutes both in the presence and absence of EDTA The lag phase was followed by a very rapid second phase only in the absence of EDTA Significantly, this lag phase was not...
- 6
- 748
- 0
INTERLEUKIN 6 RELEASE FROM t98g HUMAN GLIAL CELL LINE AS a PREDICTIVE MARKER FOR CHRONIC PAIN, AND THE CHARACTERIZATION OF SUBSTANCE(S) INVOLVED IN PAIN
... release of neurotransmitters and neuromodulators that activate the receptors on microglia and astrocytes The glial cells are activated and release pro-inflammatory cytokines and other pain enhancing ... my days as a researcher Thank you both so much for all the fun and laughter you have brought to my days in the laboratory I am also very grateful to Ms Jeyapriya Raja Sundaram for her help and ... chronic pain Amino acids and prostaglandins are two such examples 1.2.1.1 Amino Acids Glutamate is the main excitatory amino acid in the mammalian CNS Its interaction with glutamate receptors mediates...
- 136
- 600
- 0
Human embryonic stem cells as a cellular model for osteogenesis in implant testing and drug discovery
... OCT4 F: CGRGAAGCTGGAGGAGAAGGAGAAGCTG 55 oC R: AAGGGCCGCAGCTTACACATGTTC NANOG F: GGCAAACAACCCACTTCTGC 55 oC R: TGTTCCAGGCCTGATTGTTC β-ACTIN F: ACAGAGCCTCGCCTTTGCC 58 oC R: ACATGCCGGAGCCGTTGTC 2.1.5 ... study, taking hESCs differentiation towards osteogenic lineage as an example, we proposed a set of functional assays as a standard of hESCs as a model for drug discovery 29 One of the major areas ... dosage of purmorphamine (5, 10 and 20mM) was tested on the cell lines for hours following ISO 10993 standards DMSO was used as control MTS assay is a standard laboratory colorimetric assay that...
- 117
- 385
- 0
Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf
... proliferation and invasion Choriocarcinoma is a malignant neoplasm that represents the early trophoblast of the attachment phase or as later invasive stage [46–48] Thus, in most cases, choriocarcinoma ... and represents the epithelial layer separating the maternal and fetal circulation [18] In the human placenta chorionic villi, a layer of syncytiotrophoblasts lies over the cytotrophoblasts, and ... counted The sum of cell-associated and degraded 125I-labeled HDL3 reflects holoparticle association For the [3H]CE-HDL3- Total RNA was isolated from choriocarcinoma and human liver tissues (used as a...
- 12
- 470
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA ... AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT ... activation of caspase shown was calculated from the average of three experiments Each value is expressed as ratio of caspase activation level to untreated level, and the untreated level was set to *versus...
- 13
- 563
- 0
HUMAN PAPILLOMAVIRUS AND RELATED DISEASES – FROM BENCH TO BEDSIDE A DIAGNOSTIC AND PREVENTIVE PERSPECTIVE potx
... Angel Arrabal-Polo, Miguel Arrabal-Martin, Sergio Merino-Salas, Fernando López-Carmona Pintado, Salvador Arias-Santiago, Jacinto Orgaz-Molina, Maria Sierra Giron-Prieto, Santiago Melón, Mar a De ... Miguel Arrabal-Martin and Salvador Arias-Santiago Chapter Human Papillomavirus Infection and Penile Cancer: Past, Present and Future 221 João Paulo Oliveira-Costa, Giórgia Gobbi da Silveira, Danilo ... act as a transcription factor and can regulate the viral early promoter and control expression of the viral oncogenes (E6 and E7) At low levels, E2 acts as a transcriptional activator, whereas at...
- 334
- 4,718
- 0
Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc
... inhibitor cocktail (Roche, Laval, Canada) and 200 lm sodium orthovanadate (a phosphatase inhibitor; Sigma-Aldrich, Oakville, Canada) and centrifuged at 13 000 g for to remove suspended cells and ... specific band just above the major propeptide band represents the propeptide generated by the alternate signal peptidase cleavage following Ala28 instead of Ala30, as shown in the mass spectra previously ... Imgenex (San Diego, CA, USA) Secondary anti-mouse and anti- (rabbit HRP) IgG were from Amersham (Piscataway, NJ, USA) and the secondary anti-(goat HRP) IgG was from Santa Cruz Biotechnology (Santa Cruz,...
- 14
- 454
- 0
Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx
... subcellular localization, or association with as yet undefined regulatory factors The most abundant nucleoside kinase in mammals, AK has emerged as a key enzyme in the regulation of interstitial Ado and ... PAGE (15% acrylamide) and PhosphorImager analysis To calculate reaction stoichiometries, radiolabeled reaction products and radioactive standards were quantitated using IMAGEQUANT software (Amersham ... in acetone was sprayed onto the plates to visualize the phosphoamino acid standards Samples were visualized by autoradiography Results Two isoforms of AK are expressed in mouse brain AK was cloned...
- 9
- 497
- 0
Báo cáo khoa học: A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein for folding of soybean seed-storage proteins docx
... TGTAAAG TGTAAAG + ) + )95 )1100 )1470 ACACacG ACACttG ACACaaG + + + + ) ) ) ) ) )140 )1100 )1596 )1632 )140 )1100 )1596 )1632 )1874 CAaaTG CAagTG CAaaTG CAaaTG CAaaTG CActTG CAttTG CAgtTG TGAGTCA ... putative signal peptide was constructed as follows The DNA fragment was amplified from GmPDIM cDNA by PCR using the primers 5¢-GACGACGACAAGATGC ACGCACTCTATGGAGC-3¢ and 5¢-GAGGAGAAGC CCGGTTCATAGCTCATCCTTGCTTGAAG-3¢ ... soybean cotyledons during maturation (A) GmPDIM mRNA was quantified by real time RT-PCR Each value was standardized by dividing the value by that for actin mRNA Values are calculated as a percentage...
- 12
- 348
- 0
Báo cáo khoa học: RNA helicase A interacts with nuclear factor jB p65 and functions as a transcriptional coactivator pot
... with a b-galactosidase assay Each plasmid purified from the positive colony was cotransfected with the bait plasmid into the yeast to confirm the specific interaction DNA sequencing and comparison ... luciferase assay Luciferase activity was measured by the Luciferase Assay System (Promega, Madison, WI) as described previously [26] Transfection efficiency was monitored by Renilla luciferase activity ... between the N-terminal region of RHA and the C-terminal GIR of p65 As the TA1-like and TA1 domains of p65 themselves recruit CBP/ p300 coactivators, RHA appears to further facilitate the coactivator...
- 11
- 485
- 0
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot
... of an N-terminal b-sandwich, a core (which contains a transamidation site and a Ca2+-binding site, and has a helices and b sheets in equal amounts), and two C-terminal b-barrel domains It has ... Esposito and I Caputo 132 Akagi A, Tajima S, Ishibashi A, Matsubara Y, Takehana M, Kobayashi S & Yamaguchi, N (2002) Type XVI collagen is expressed in factor XIIIa+ monocyte-derived dermal dendrocytes ... intracellular signalling and apoptosis, as well as in neurodegenerative and autoimmune diseases Consequently, its function may depend on its subcellular and cellular localization and on access to proteins...
- 17
- 440
- 0
báo cáo hóa học:" Combined intermittent hypoxia and surface muscle electrostimulation as a method to increase peripheral blood progenitor cell concentration" pot
... FA, Ventura JL, Casas M, Casas H, Pages T, Rama R, Ricart A, Palacios L, Viscor G: Erythropoietin acute reaction and haematological adaptations to short, intermittent hypobaric hypoxia Eur J Appl ... and/ or assembly of data, data analysis and interpretation, manuscript writing; GMH: collection and/ or assembly of data, data analysis and interpretation, manuscript writing; CA: collection and/ or ... and/ or assembly of data, data analysis and interpretation, manuscript writing; RS: data analysis and interpretation, manuscript writing All authors read and approved the final manuscript Additional...
- 6
- 426
- 0
báo cáo hóa học:" Aberrant expression and potency as a cancer immunotherapy target of alpha-methylacyl-coenzyme A racemase in prostate cancer" pptx
... Tamura Y, Aketa K, Nabeta C, Nakanishi K, Kamiguchi K, Mano Y, Kitamura H, Kobayashi J, Tsukahara T, Shijubo N, Sato N: Aberrant expression and potency as a cancer immunotherapy target of inhibitor ... Takeda Pharmaceutical Co (Osaka, Japan), Ono Pharmaceutical Co (Osaka, Japan) and Novartis Pharmaceutical (Basel, Switzerland), respectively Human recombinant IL-7 was purchased from Invitrogen ... prostate cancer patients (cases 3, and 5) with AMACR peptides exerted cytotoxic activity against LNCaPA*2402 and DU145 -A* 2402 cells but not against LNCaP and DU145 cells These data implied that the...
- 11
- 531
- 0
báo cáo sinh học:" The double burden of human resource and HIV crises: a case study of Malawi" docx
... contracts and payment due to administrative delays One problem was that the promised 52% salary top-up was not translated into a 52% increase in take-home pay because of changes to the tax and allowance ... sector and CHAM staff through a 52% salary topup for 11 professional and technical cadres, coupled with a major initiative to recruit and re-engage qualified Malawian staff The Emergency Human ... DM and BM drafted the paper on the basis of two separate papers they had individually authored VM made significant contributions to the original draft with particular reference to the Malawi case...
- 13
- 585
- 0
Financial Audit of the Department of Human Resources Development A Report to the Governor and the Legislature of the State of Hawai‘i Report No. 07-09 December 2007_part1 ppt
... enacted, the statutes require that the measure be analyzed by the Office of the Auditor as to its probable effects Health insurance analyses examine bills that propose to mandate certain health ... in the final report and believe our audit report presents a balanced and accurate analysis of the department’s financial operations Marion M Higa State Auditor State of Hawai‘i Office of the Auditor ... the Auditor with broad powers to examine all books, records, files, papers, and documents and all financial affairs of every agency The Auditor also has the authority to summon persons to produce...
- 10
- 255
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25