filtering on any column of a table with a limit on rows
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); ... et al Glucoamylase raw starch binding site reverse (5¢-GTTCATTCAAGGAGCCATCAGCATTAAT AGCATCCAAAATGACTTGC-3¢) All mutations were verified by DNA sequencing Glucoamylase Glu Enzyme preparation and...
- 11
- 548
- 0
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
... be an irrational number with continued fraction expansion θ = [a1 , a2 , a3 , ], and consider the quadratic polynomial Pθ : z → e2πiθ z + z By performing a trans-quasiconformal surgery on an ... optimal arithmetical condition EDE on θ does the linearization hθ admit a David extension H : D → D? Question Under what optimal arithmetical condition EDI on θ does the model Fθ admit an invariant ... universal Similarly, bn , we say that an and bn are comparable up to a constant when an which is asymptotically universal Finally, let {an = an (x)} and {bn = bn (x)} depend on a parameter x belonging...
- 53
- 383
- 0
báo cáo hóa học: " Impact of a child with congenital anomalies on parents (ICCAP) questionnaire; a psychometric analysis" pptx
... Primary anomalies Abdominal wall defect Congenital diaphragmatic hernia Small intestinal anomaly Oesophageal atresia Anorectal malformation Hirschsprung's disease Miscellaneous Congenital anomalies ... a new questionnaire designed to evaluate parental early stress and quality of life in the first months after the birth of a child with (M)CA, the Impact of a Child with Congenital Anomalies on ... questionnaire was constructed as a self-report questionnaire for parents of children with any kind of CA As an initial step we reviewed relevant questionnaires on psychological and social functioning...
- 10
- 508
- 0
báo cáo hóa học: " Shedding light on walking in the dark: the effects of reduced lighting on the gait of older adults with a higher-level gait disorder and controls" ppt
... effects of an attention demanding task on the gait of healthy young and older adults [35,36] When healthy young or older adults are asked to walk and perform an additional task simultaneously, gait ... over fall at least once each year [14] and among patients with a HLGD, falls are apparently much more frequent [9] Previous studies have demonstrated that impaired vision is an important and independent ... fear of falling that appears to be related to this increased stride variability, and have an increased risk of falls [8,9] Further, the extrapyramidal, limbic systems, and the frontal lobe apparently...
- 8
- 415
- 0
báo cáo hóa học:" Spontaneous regression of curve in immature idiopathic scoliosis - does spinal column play a role to balance? An observation with literature review" pot
... differential pressure loading on the growth plate [31] Eular’s Law of viscoelastic buckling of a spine in the coronal and transverse planes Page of leading to a lateral bend and axial rotation/torsional ... and acquisition of data, analysis and interpretation of data, drafting the manuscript and revising it critically, SWS has contributed in conception and design of data, drafting the manuscript and ... final approval of manuscript, JHY has contributed in acquisition of data, revising the manuscript critically and given the final approval, JYH has contributed in acquisition of data and analysis...
- 8
- 381
- 0
báo cáo hóa học:" Impact of a child with congenital anomalies on parents (ICCAP) questionnaire; a psychometric analysis" pot
... Primary anomalies Abdominal wall defect Congenital diaphragmatic hernia Small intestinal anomaly Oesophageal atresia Anorectal malformation Hirschsprung's disease Miscellaneous Congenital anomalies ... a new questionnaire designed to evaluate parental early stress and quality of life in the first months after the birth of a child with (M)CA, the Impact of a Child with Congenital Anomalies on ... questionnaire was constructed as a self-report questionnaire for parents of children with any kind of CA As an initial step we reviewed relevant questionnaires on psychological and social functioning...
- 10
- 366
- 0
Báo cáo toán học: " Shrinking projection algorithms for equilibrium problems with a bifunction defined on the dual space of a Banach space" doc
... 17 Takahashi, W: Nonlinear Functional Analysis-Fixed Point Theory and Its Applications Yokohama Publishers (2000) 18 Xu, HK: Inequalities in Banach spaces with applications Nonlinear Anal (TMA) ... Y: Metric and generalized projection operators in Banach spaces: properties and applications In: Kartsatos AG (ed.) Theory and Applications of Nonlinear Operators of Monotonic and Accretive Type ... 11 Honda, T, Takahashi, W, Yao, JC: Nonexpansive retractions onto closed convex cones in Banach spaces Taiwanese J Math 14, 1023–1046 (2010) 12 Kohsaka, F, Takahashi, W: Generalized nonexpansive...
- 11
- 396
- 0
Báo cáo hóa học: " On calculation of eigenvalues and eigenfunctions of a Sturm-Liouville type problem with retarded argument which contains a spectral parameter in the boundary condition" pot
... retardation obtained Şen and Bayramov Journal of Inequalities and Applications 2011, 2011:113 http://www.journalofinequalitiesandapplications.com/content/2011/1/113 Authors’ contributions Establishment ... of eigenvalues and eigenfunctions of a Sturm-Liouville type problem with retarded argument which contains a spectral parameter in the boundary condition Journal of Inequalities and Applications ... problem with retarded argument which contains a spectral parameter in the boundary condition Then, under additional conditions (a) and (b) the more exact asymptotic formulas, which depend upon the...
- 9
- 410
- 0
Báo cáo hóa học: " Improvement on thermal performance of a diskshaped miniature heat pipe with nanofluid" docx
... and the average diameter of a carbon nanoparticle was approximately 68 nm For convenience, the mixture of multiwall carbon nanotubes and carbon nanoballs in the base fluid was still called carbon ... a greater viscosity of the nanofluid The measured values of the thermal conductivity of nanofluids and DI water are also listed in Table The thermal conductivity of nanofluid with gold nanoparticles ... Japan) micrograph of the gold nanoparticles with an average diameter of 17 nm; the volume fraction of the gold nanoparticles in the nanofluid was about 0.17% There are several types of carbon nanoparticles...
- 7
- 386
- 0
Báo cáo hóa học: " On general filtering problem of stationary processes with fixed transformation" pot
... general filtering problem of stationary processes with fixed transformation Journal of Inequalities and Applications 2011 2011:68 Submit your manuscript to a journal and benefit from: Convenient online ... Journal of Inequalities and Applications 2011, 2011:68 http://www.journalofinequalitiesandapplications.com/content/2011/1/68 Page of 10 Then, according to the equation (3-8), we get that the equation ... one-dimensional a stationary processes in this paper Also, we propose a general filtering problem Then, in the space of L2(FX (dl)), we get the spectral characteristics of PHη (t) ξ with no any additional...
- 10
- 290
- 0
Báo cáo hóa học: " Enhancements of thermal conductivities with Cu, CuO, and carbon nanotube nanofluids and application of MWNT/water nanofluid on a water chiller syste" docx
... most suitable condition for production and application of CNT/water nanofluid has been proposed based on statistical analysis of the results It has been shown that more stable nanofluid may not ... concentration, surfactant type and concentration, pH, temperature, power of ultrasonication and elapsed time after ultrasonication, and their interactions have been investigated experimentally The ... conductivity ratios with the addition of different nanoparticles For practical applications of nanofluids, a constructal approach is proposed by Wang and Fan [18] recently It is based on the constructal...
- 13
- 393
- 0
báo cáo hóa học:" Research Article On Homoclinic Solutions of a Semilinear p-Laplacian Difference Equation with Periodic Coefficients" pptx
... such kind of problems can be placed at the interface of certain mathematical fields, such as nonlinear differential equations and numerical analysis On the other hand, they are strongly motivated by ... differential equations,” Journal of Mathematical Analysis and Applications, vol 240, no 1, pp 163–173, 1999 W Omana and M Willem, “Homoclinic orbits for a class of Hamiltonian systems,” Differential and ... solutions of singular and nonsingular discrete problems via variational methods,” Nonlinear Analysis: Theory, Methods & Applications, vol 58, no 1-2, pp 69–73, 2004 11 A Cabada, A Iannizzotto, and...
- 17
- 365
- 0
báo cáo hóa học:" Research Article Note on the Persistent Property of a Discrete Lotka-Volterra Competitive System with Delays and Feedback Controls" pptx
... LotkaVolterra competitive system with delays and feedback controls,” Journal of Computational and Applied Mathematics, vol 211, no 1, pp 1–10, 2008 S Ahmad, On the nonautonomous Volterra-Lotka ... Gopalsamy, Stability and Oscillations in Delay Differential Equations of Population Dynamics, vol 74 of Mathematics and Its Applications, Kluwer Academic Publishers, Dordrecht, The Netherlands, ... S Ahmad and I M Stamova, “Almost necessary and sufficient conditions for survival of species,” Nonlinear Analysis Real World Applications, vol 5, no 1, pp 219–229, 2004 10 Y.-H Fan and L.-L Wang,...
- 9
- 351
- 0
báo cáo hóa học:" Research Article Efficient Processing of a Rainfall Simulation Watershed on an FPGA-Based Architecture with Fast Access to Neighbourhood Pixels" pptx
... If the image has regions where the pixels have the same value and are not a regional minimum, they are called nonminima plateaus The nonminima plateaus are a group of pixels which can be divided ... the arrowing and labelling results were verified to have the same values as software simulations in Matlab The Spartan-3 FPGA contains a total of 13312 slices The implementation results of the architecture ... “flow” to a particular catchment basin will assume that catchment basin’s label The catchment basins have been circled and the pixels that are associated with it are labelled and shaded correspondingly...
- 19
- 306
- 0
Báo cáo hóa học: "Research Article The Solvability of a Class of General Nonlinear Implicit Variational Inequalities Based on Perturbed Three-Step Iterative Processes with Errors" potx
... class of variational inclusions,” Journal of Mathematical Analysis and Applications, vol 201, no 2, pp 609–630, 1996 C Baiocchi and A Capelo, Variational and Quasivariational Inequalities: Applications ... Siddiqi and Q H Ansari, “Strongly nonlinear quasivariational inequalities,” Journal of Mathematical Analysis and Applications, vol 149, no 2, pp 444–450, 1990 22 A H Siddiqi and Q H Ansari, “General ... Liu, J S Ume, and S M Kang, “General strongly nonlinear quasivariational inequalities with relaxed Lipschitz and relaxed monotone mappings,” Journal of Optimization Theory and Applications, vol 114,...
- 13
- 251
- 0
Báo cáo hóa học: " Letter to the Editor A Further Result about “On the Channel Capacity of Multiantenna Systems with Nakagami Fading”" potx
... example, Maple and Mathematica REFERENCES [1] F Zheng and T Kaiser, On the channel capacity of multiantenna systems with Nakagami fading,” EURASIP Journal on Applied Signal Processing, vol 2006, Article ... could be useful with respect to channel capacity modeling of multiantenna systems with Nakagami fading The given expressions involve the digamma, exponential integral, imaginary error, and the hypergeometric ... Table of Integrals, Series, and Products, Academic Press, San Diego, Calif, USA, 6th edition, 2000 Saralees Nadarajah is a Senior Lecturer in the School of Mathematics, University of Manchester,...
- 2
- 271
- 0
Báo cáo hóa học: " Research Article On Stability of a Functional Equation Connected with the Reynolds Opera" docx
... Isac, and Th M Rassias, Stability of Functional Equations in Several Variables, vol 34 of Progress in Nonlinear Differential Equations and Their Applications, Birkh¨ user Boston, a Boston, Mass, ... Boston, Mass, USA, 1998 [2] J Acz´ l and J Dhombres, Functional Equations in Several Variables, vol 31 of Encyclopedia of e Mathematics and Its Applications, Cambridge University Press, Cambridge, ... Journal of Inequalities and Applications Banach algebra Ꮽ They have shown that if a mapping f : X → Ꮽ satisfies f (x ◦ y) − f (x) f (y) ≤ (3) with some > 0, then there exist a commutative C ∗ -algebra...
- 3
- 216
- 0
ON WEAK SOLUTIONS OF THE EQUATIONS OF MOTION OF A VISCOELASTIC MEDIUM WITH VARIABLE BOUNDARY V. G. pptx
... consideration by an operator equation, approximation of the equation in a weak sense and application of the topological theory of a degree that allows to establish the existence of solutions on ... basis of a priori estimates and statements about passage to the limit Note that in the case of a not cylindrical domain (with respect to t) the necessary spaces of differentiable functions cannot ... taking of the normal component of a trace on the boundary of a function defined on Ω0 The operator γn 236 On weak solutions of the equations of motion 1/2 is bounded as an operator from W2 (Ω0...
- 31
- 266
- 0
Báo cáo nghiên cứu khoa học: " LEVEL SET EVOLUTION WITH SPEED DEPENDING ON MEAN CURVATURE: EXISTENCE OF A WEAK SOLUTION" pps
... mean curvature flow equation (2.4) with initial condition (2.5) A weak solution will be obtained by passing to limits of classical solutions of an approximate problem We will assume that for the ... motivation for our definition of weak solution, and, particular, an explanation as to n why we assume η ≤1 in the definition will be found in Section III 2.2 Properties of weak solutions u k is a ... supersolutions and solutions Theorem 2.2 Assume u is a weak solution of (2.4) and Ψ : R → R is continuous Then v := Ψ (u ) is also a weak solution of (2.4) The proofs of these theorems can be done similarly...
- 10
- 336
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25