effects of a single low and high dose cyc on 5t2mm progression
báo cáo hóa học:" Effects of hip joint position and intra-capsular volume on hip joint intra-capsular pressure: a human cadaveric model" pdf
... The authors declare that they have no competing interests Authors' contributions All authors had substantial contributions to conception and design, analysis and interpretation of data, drafting ... (Bristol, Avon) 1997, 12(5):273-280 Wingstrand H, Wingstrand A, Krantz P: Intracapsular and atmospheric pressure in the dynamics and stability of the hip A biomechanical study Acta Orthop Scand 1990, ... Nilsson LT, Thorngren KG, Onnerfalt R: Traumatic hip joint tamponade Two cases with femoral head ischaemia Acta Orthop Scand 1985, 56(1):81-5 Robertsson O, Wingstrand H, Onnerfalt R: Intracapsular...
- 6
- 421
- 0
Báo cáo lâm nghiệp: "Contribution of different solutes to the cell osmotic pressure in tap and lateral roots of maritime pine seedlings: effects of a potassium deficiency and of an all-macronutrient deficienc" pptx
... detection and an autosuppression recycle mode (Dionex DX 300, Sunnyvale, USA) This was associated with an automatic were 2.4.3 Amino-acid analysis Extraction was carried out at °C 40 μL of internal ... of a bunch of primary leaves), of the tap root (TR) and of the three longest lateral roots (LR; as an assessment of the length of the lateral roots) of each plant were measured just before harvest ... that P concentrations measured = = content with 2.4.2 Soluble sugar analyses detected by a thermal To determine K, Na, Mg, Ca and P contents, 20 mg of each sample were dry-ashed at 500 °C and ashes...
- 13
- 385
- 0
Báo cáo y học: " Carinal surgery: experience of a single center and review of the current literature" potx
... optimal anaesthetic and surgical strategies are to be taken into consideration Anaesthetic strategies Multidisciplinary team approach and close collaboration with the anaesthetist, is required Page ... Scan of the chest, PET scan, schematic representation of the tumor and Bronchoscopy before and after carinal resection showing tracheo-bronchial anastomosis Parissis and Young Journal of Cardiothoracic ... long term survivors following RSP at 50 and 39 months Finally, the only patient with the Tracheal sarcoma was alive at 29 months and the patients with the carcinoid tumors were alive at 26 and...
- 7
- 311
- 0
Báo cáo y học: "Demonstration of the histopathological and immunohistochemical effects of a novel hemostatic agent, ankaferd blood stopper, on vascular tissue in a rat aortic bleeding mode" pps
... of Laboratory Animal Care” formulated by the National Society for Medical Reseacrh and “Guide for the Care and the Use of Laboratory Animlas” prepared by the US Natinoal Academy of Sciences and ... new, a limited amount of data is available related to long-term side effects and toxicity [1,21] A limitation of this study is that only acute and earlystage effects of ABS were evaluated Long-term ... proximal to the iliac bifurcation using an iris blade ABS solution (1 mL) in a glass vial was poured on a gauze tampon through a syringe Either an ABS-soaked or plain gauze tampon was applied to Page...
- 7
- 454
- 0
The relative effects of merit pay, bonuses, and long term incenti on future job performance
... performance, affective commitment, and work motivation: the roles of pay administration and pay level Journal of Organizational Behavior, 27: 365385 Lawler, E.E (1971) Pay and managerial effectiveness: A ... company studies by Kahn and Sherer (1990), what was called a merit pay plan was not really a pay-for-performance plan (because there appeared to be no relationship between pay and performance) As ... from an economic perspective, the liquidity of cash bonuses causes such rewards, on a dollarper-dollar basis, to have a greater present value than a comparably sized stock award That is, a $1 award...
- 35
- 517
- 0
Báo cáo hóa học: " A retrospective evaluation of the impact of a dedicated obstetric and neonatal transport service on transport times within an urban setting" pptx
... compare categorical data A mixed models analysis was employed using SAS Systems A repeated-measures ANOVA was used, where the year was regarded as the repeated measure and the factor was the variable ... execute the neonatal transfers Therefore, ambulances avoided wasting time in an attempt to locate a neonatal ventilator or working incubator The allocation of a dedicated ambulance ensured that vehicle ... this article as: De Vries et al.: A retrospective evaluation of the impact of a dedicated obstetric and neonatal transport service on transport times within an urban setting International Journal...
- 6
- 432
- 0
Báo cáo lâm nghiệp: "Effects of watering after lifting and exposure before planting on plant quality and performance in Oriental spruce " pptx
... Douglas fir and the ponderosa pine should have a water potential of greater than -0.5 MPa in order to avoid low survival and poor growth The same results have also been established for radiata pine ... parameters of plant performance were measured on 90 plants from each treatment (table II) Relative increments of the height and dry weight of transplants were then calculated Proportional data ... level and located on acidic soils (pH 5.3) with sandy loam texture Trials were set up with 4-year-old transplants of Picea orientalis from the provenance of Cataldere-Maden as three replications...
- 5
- 291
- 0
Báo cáo y học: " Effects of Cowpea mottle virus and Cucumber mosaic virus on six Soybean (Glycine max L.) cultivars" docx
... after planting Data collection and analysis Data were collected at the time of infection as well as on weekly basis Plant height and number of leaves were taken weekly over a period of weeks after ... America Phytopathologyical Society 1975 IITA: Annual Report Ibadan Nigeria IITA 1975:136 Anno Nyako FO: Identification, partial characterization and some properties of a virus causing a mild ... dearth of information on such a phenomenon, the objective of this study was to examine the effects of single and mixed infection by CMeV and CMV on growth and yield parameters of six Cultivars of...
- 5
- 257
- 0
chi et al - 2010 - the effects of auditors’ pre-client and client-specific experience on earnings quality and perceptions of earnings quality in taiwan
... literature uses various measures of accruals to proxy for earnings quality We follow Kothari, Leone, and Wasley (2005) and Chen et al (2008), and calculate performancematched discretionary accruals ... plant and equipment at the end of year t; ROAt–1 = return on assets in year t-1, calculated as the ratio of income before discontinued operations and extraordinary items to total assets; and TAt–1 ... Contemporary Accounting and Economics (1): 65-92 Chi, W., H Huang, Y Liao, and H Xie 2009 Mandatory audit-partner rotation, audit quality and market perception: Evidence from Taiwan Contemporary...
- 40
- 455
- 0
Effects of the three obediences and four virtues ethics on vietnamese women in the present time
... at Ho Chi Minh National Academy of Politics At hour day month 2014 Further information: National Linbrary of Vietnam and Library of Ho Chi Minh National Academy of Politics INTRODUCTION Rationale ... historical period and each different dynasty, the position and role of Confucianism are different In one thousand year of feudalism, Confucian in general and the theory of “Father - Husband - Son” and ... “Work-Appearance- WordCharacter” in particular had a profound influence on the Vietnamese life and people Confucian contributed to build the national traditions, ideology and culture and the image...
- 29
- 910
- 0
NGHIÊN cứu ẢNH HƯỞNG của điện áp ĐÁNH lửa và CƯỜNG độ DÒNG PHÓNG TIA lửa điện đến độ NHÁM bề mặt CHI TIẾT KHI GIA CÔNG THÉP 40cr TRÊN máy CHMEREDM CW 420HS THE EFFECTS OF BREAKDOWN POTENTIAL PARAMETER AND SPARK DISCHARGE POWER ON SURFACE
... E.C.Jameson, Electrical Discharge Machining – Tooling, Methods And Application, Dearborn Michigan, USA (1983) [10] Indrajit Basak, Amitabha, Jounal of Materials Processing Technology, Krakow, 1997 ... Electrical discharge machining Tooling, method and application, Hannover university, Germany, 2001 [8] Erik L.J Bohez, Electrical Discharge Machining School of advanced Technology, 1995 [9] E.C.Jameson, ... quan hệ điện a p a nh lư a (Uz) và dòng phóng tia lư a điện (Ie) đến độ nhám bề mặt (Ra) chi tiết thể hiện qua công thức (1) là hàm phi tuyến, tính toán ta chuyển sang hàm logarit...
- 8
- 634
- 3
Báo cáo khoa học: " In vivo assessment of catheter positioning accuracy and prolonged irradiation time on liver tolerance dose after single-fraction 192 Ir high-dose-rate brachytherapy" pot
... registration accuracy for the liver Registration accuracy was validated using intrahepatic vessel bifurcations as landmarks Three to four landmarks were set in the CT and MRI image data of ten patients ... images) and corresponding liver tolerance doses as well as the standard deviation between the examinations at and 12 weeks (6W and 12W) A total of 96 follow-up MRI examinations of 30 patients ... Lüdemann et al.: In vivo assessment of catheter positioning accuracy and prolonged irradiation time on liver tolerance dose after single- fraction 192Ir high- dose- rate brachytherapy Radiation Oncology...
- 10
- 317
- 0
Báo cáo y học: "Vaccination response to tetanus toxoid and 23-valent pneumococcal vaccines following administration of a single dose of abatacept: a randomized, open-label, parallel group study in healthy subjects" pot
... in accordance with the ethical principles of the Declaration of Helsinki and was approved by Institutional Review Boards All subjects gave informed consent Drug administration and vaccination Abatacept ... repeated-measures analyses of covariance on the natural logarithm of the antibody levels, with the treatment group and the study day as factors and the log of the baseline (prevaccination) antibody ... by ELISA at 14 and 28 days after vaccination by a central laboratory Abatacept serum concentrations were measured at the same time as the antibody titers were determined This study was carried...
- 11
- 415
- 0
Báo cáo y học: " The effects of low and high glycemic index foods on exercise performance and beta-endorphin responses" pdf
... collected and analysed data, and wrote the manuscript TT collected and analysed data IF participated in the design of the study, analysed data and reviewed the manuscript MGN analysed data and performed ... the statistical analysis VP analysed data and reviewed the manuscript CY collected and analysed data SR analysed data YK reviewed the manuscript All authors reviewed and approved the manuscript ... in metabolism and fatigue perception during exercise For example, Fatouros et al [4] manipulated the carbohydrate intake of rats and found a higher concentration of b-endorphin in plasma and hypothalamus...
- 11
- 400
- 0
Báo cáo khoa học: " Risk Factors for High Endoparasitic Burden and the Efficiency of a Single Anthelmintic Treatment of Danish Horses" doc
... aim of validating the questionnaire (Lendal et al 1998) Data analysis Initially bivariate analyses were performed, and variables having p-values below 0.15 were included in the multivariate analysis ... M Larsen et al be an indication that AR has developed Some parasites survive treatment, what facilitates selection of AR parasites (Prichard 1994) This makes it necessary to investigate the association ... (0,0746) any immunity, which means that a greater accumulation of encysted cyathostominea in the caecal and colonic mucosa is allowed In this stage they not yet contribute with massive faecal egg...
- 8
- 294
- 0
Báo cáo sinh học: " Effects of selection for early and late reproduction in low and high larval density populations of the bean weevil" pdf
... one-generation selection for early and late reproduction in populations maintained for 10 generations at low and high levels of larval density work on MATERIALS AND METHODS Life history of Acanthoscelides ... Through each pair’s mortality rate data the least square linear regression was calculated as well None of the estimated average mortality rate differences between any pair of compared populations ... early and late-reproduced parents within populations with low and high larval densities The average longevity, fecundity > 10 d, last d of egg laying, age of peak fecundity and laying rate were higher...
- 14
- 313
- 0
Sequential effects of a high fat, calorie dense diet or a high fiber diet on gene expression, body weight and associated metabolic responses in c57 BL6J mice
... OXIDATION Fatty acid synthase (Fas), a key-regulating enzyme in de novo lipogenesis, catalyzes all the reactions for the conversion of acetyl-coenzyme A and malonyl-CoA to palmitate (Wakil et al., ... saturated fat (Lichtenstein, 2006) Not all saturated fatty acids have identical effects on plasma cholesterol concentrations Studies have concluded that saturated fatty acids, particularly lauric ... acid biosynthesis This provides a mechanism for physiological regulation of betaoxidation in all mammalian tissues and for cellular fuel sensing based on the availability of fatty acids (McGarry...
- 228
- 231
- 0
Phase behaviour and modeling of low and high solid biopolymer mixtures a treatise
... Calibration curves of storage modulus as a function of polymer concentration for agarose and gelatin at and 25°C 33 Figure 4.4 Storage and loss modulus variation as a function of temperature and ... of observation for gelatin and agarose on cooling to 0oC 29-30 Figure 4.2 Storage and loss modulus variation as a function of temperature and time of observation for gelatin and agarose on cooling ... representations of ideal rubber, gelatin and agarose Figure 1.3 Changes in calculated modulus as a function of SX Figure 4.1 Storage and loss modulus variation as a function of temperature and time of...
- 129
- 201
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... interface of PfTIM DHAP Fig Key backbone hydrogen bonds between K12 and the side chains of N10 and Q64, which maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter ... Borchert TV, Abagyan R, Jaenicke R & Wierenga RK (1994) Design, creation, and characterization of a stable, monomeric triosephosphate isomerase Proc Natl Acad Sci USA 91, 15151518 15 Casal JI, Ahern...
- 15
- 635
- 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... Discussion Computational studies confirm that the conformational space of b-amino acids is larger than that of a- amino acids, but low- energy conformations of the b-amino acids backbone, corresponding ... solvent variation, causing an underestimation of calculated CSDs These CSDHa and CSDCa variations demonstrate the formation of more stable and abundant helical structures for [Aib9]SP than for ... conformations, whereas b3-HAla has a more limited conformational space (Fig 2) For both gauche(–) and gauche(+) conformers, regions of the (/ – w) diagram can overlap canonical b-sheet, a- helix and...
- 11
- 860
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25