deconstructing time resolved optical rotatory dispersion kinetic measurements of cytochrome c folding from molten globule to the native state
Báo cáo Y học: Binding of Thermomyces (Humicola) lanuginosa lipase to the mixed micelles of cis-parinaric acid/NaTDC Fluorescence resonance energy transfer and crystallographic study ppt
... upon addition of cis-PnA, probably due to the physico-chemical state of cis-PnA in the absence of NaTDC micelles However, the presence of cis-PnA led to a quenching of the fluorescence emission ... lines); C9 and C1 0 correspond to the position of these atoms in the OA_A ligand, where the electron density was visible from its carboxylic group up to the C9 -C1 0 carbon atoms: the alkyl chain of ... that the lid is involved in the binding of the mixed micelles of cis-PnA/NaTDC On the other hand, these shifts might result from the quenching of the tryptophan fluorescence in the presence of the...
- 9
- 424
- 0
Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx
... GGCTAACAATGCATCTCT-3¢), and a BamHI site (bold) was introduced into the reverse primer (5¢-TCTCC CGGATCCAAAGAGAAATACCCATA-TA-3¢) to facilitate vector–insert ligation Amplification conditions were at 92 C, ... with confocal microscopy In cells expressing each of these receptor constructs, GFP and EYFP were localized on the plasma membrane (Fig 2B ,C) , showing that the addition of GFP or EYFP to the C- terminal ... in the prepared vector The ligation mixture was transformed into XL1Blue cells according to the manufacturer’s protocol Transfection and amplification of recombinant baculoviruses BTI Tn5 B1-4 cells...
- 9
- 380
- 0
Báo cáo sinh học: "Combined optical trapping and single-molecule fluorescence" doc
... electronically by means of acousto-optic deflectors (AODs) placed at optical planes conjugate to the back focal plane of the objective The output optics, including a cooled, intensified charge-coupled ... charge-coupled device (CCD) camera, a conventional black-and-white CCD camera, and two silicon avalanche photodiodes (SAPDs), are shown to the left of the microscope, inside the box labeled in green The identities ... photodiode [4] while fluorescence was monitored by counts on an avalanche photodiode (APD; EG&G Optoelectronics, Gaithersburg, USA), collected through a confocal pinhole The area of regard of the...
- 4
- 167
- 0
Tài liệu Báo cáo khoa học: DNA strand exchange activity of rice recombinase OsDmc1 monitored by fluorescence resonance energy transfer and the role of ATP hydrolysis pptx
... TGTCACGCTGATTATTTTGACTTTGAGCGTATCG-3¢ and M1 3C: 5¢-CTACAACGCCTGTAGCATTCCACAGA CAGCCCTCATAGTTAGCGTAACGAGATCG-3¢ Phi -C and Phi-W were complementary to each other Phi -C was labeled with rhodamine at the 3¢ end ... synthesized by Metabion (Martinsreid, Germany) with the following sequences: PhiC: 5¢-CGATACGCTCAAAGTCA AAATAATCAGCGTGACATTCAGAAGGGTAATAAG AACG-3¢;, PhiW: 5¢-CGTTCTTATTACCCTTCTGAA TGTCACGCTGATTATTTTGACTTTGAGCGTATCG-3¢ ... stimulated the search for homologues of RecA in eukaryotes using classical biochemical techniques, which did not yield much success Introduction of molecular techniques led to identification of two RecA...
- 10
- 568
- 0
Tài liệu Báo cáo khoa học: Constitutive oligomerization of human D2 dopamine receptors expressed in Spodoptera frugiperda 9 (Sf9 ) and in HEK293 cells Analysis using co-immunoprecipitation and time-resolved fluorescence resonance energy transfer pdf
... for the construction of recombinant baculoviruses encoding FLAG-tagged D2 receptors, using, in this case, the following oliogonucleotide encoding the FLAG epitope sequence: 5¢-GCGGCCGCATGGACTACAAGGACGACGATGA ... affect the function of the two isoforms of the receptors, with possible direct consequences on the effect of antipsychotic drugs Acknowledgements This work was supported by the BBSRC and the ... 5¢-GCGGCCGCATGGACTACAAGGACGACGATGA CAAGGATCCACTGAATCTGTCCTGG-3¢ This sequence contains, in addition to nucleotides corresponding to the FLAG sequence, a NotI site and a start codon in its 5¢ end Other modifications...
- 11
- 618
- 0
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx
... oligonucleotides, 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTGGT-3¢, into the XbaI site of pBOS Vector pBOS-Myc ... constructed similarly by using the synthesized oligonucleotides 5¢-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3¢ and 5¢-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTCACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, ... primers 5¢-CGTGACCACCCTGACCGCGGG CGTGCAGTGCTTC-3¢ and 5¢-GAAGCACTGCACGCC CGCGGTCAGGGTGGTCACG-3¢ pCerulean(W66A)elongin C- citrine was constructed by inserting the BsrGI-EcoRI fragment of pcerulean-elongin...
- 9
- 420
- 0
Báo cáo khoa học: Dimerization of mammalian adenylate cyclases Functional, biochemical and ¯uorescence resonance energy transfer (FRET) studies pot
... triggered by store depletion (capacitative Ca2+-entry; CCE) or especially the combination of forskolin and CCE (Fig 1A) Replacing half of the AC8 cDNA with empty vector caused no drop in cAMP accumulation ... constructs were cotransfected into HEK 293 cells Pictures in each row were captured from the same cell The ®rst (CFP) and the second (YFP) columns show the CFP ¯uorescence and YFP ¯uorescence, respectively ... adenylate cyclases and CCE channels are intimately colocalized, with the result that only Ca2+ entering via CCE channels can regulate these cyclases (including AC8) while the release of Ca2+ from...
- 9
- 233
- 0
SINGLE MOLECULE STUDY ON DNA PROTEIN INTERACTION IN PROKARYOTES AND EUKARYOTES
... used to measure the force The extension of the tether is determined from the center of the bead to the edge of the cover glass The real -time extension of the DNA tether can be tracked by magnetic ... difference to force the DNA to compact However, the depletion force is much smaller than the force needed to condense DNA into such a small space Therefore, architectural proteins are needed to compact ... tether length plus the bead radius Bead fluctuation along the y-direction is used to measure the force The extension of the tether is determined from the center of the bead to the edge of the cover...
- 74
- 1,019
- 0
Tài liệu Báo cáo khoa học: Loose interaction between glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate kinase revealed by fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy in living cells doc
... using the primers 5¢-CCGGA ATTCC AATGT CGCTT TCTAA CAAGC T-3¢ and 5¢-GGCGG ATCCA TAATA TTGCT GAGAG CATCC A-3¢, and 5¢CCGGA ATTCC AATGT CGCTT TCTAA CAAGC T-3¢ and 5¢-CGACC GGTAT AATAT TGCTG AGAGC ... interactions in the complex in living cells C- 3¢, and pcerulean -C1 For the construction of phGAPDH– 10aa–citrine, the synthetic oligonucleotides 5¢-GATCC GGGCG CCGGA-3¢ and 5¢-CCGGT CCGGC GCCCG3¢ ... of pcerulean-N1 pcerulean–hPGK1 was constructed using the primers 5¢CCGGA ATTCG ATGTC GCTTT CTAAC AAGCT-3¢ and 5¢-GGCGG ATCCT TAAAT ATTGC TGAGA GCATC 1316 CHO-K1 cells were obtained from the Cell...
- 9
- 586
- 0
Báo cáo Y học: Probing intermolecular protein–protein interactions in the calcium-sensing receptor homodimer using bioluminescence resonance energy transfer (BRET) potx
... Biochem 269) except for its signal peptide The c- myc-CaRD1036-Rluc, c- myc-CaRD886-Rluc receptors were created by subcloning of the EcoRI–NotI segments of the respective Rluc-tagged CaRs into c- myc-CaR ... HA-tagged CaRs Visualization of cell surface expression of tsA cells transfected with c- mycCaR/HA-CaR, c- myc-CaRD1036-Rluc/HA-CaRD1036-GFP2 and c- myc-CaRD886-Rluc/HA-CaRD886-GFP2, respectively The ... and acceptor molecules had to be present in the same cell in order to elicit BRET (Fig 7C) Another important factor to consider was the ratio between the fluorescence signal and the luminescence...
- 12
- 445
- 0
Báo cáo khoa học: Receptor- and calcium-dependent induced inositol 1,4,5-trisphosphate increases in PC12h cells as shown by fluorescence resonance energy transfer imaging pot
... result from the release of Ca2+ from intracellular stores, whereas subsequent sustained calcium increases reflect calcium entry, including the so-called storeoperated calcium (SOC), which is activated ... presence of calcium initially enhanced receptor-induced Ins(1,4,5)P3 By contrast to the immediate restoration of intracellular calcium, the removal of extracellular calcium led to a gradual decrease ... both calcium and CCh reduced the receptor- and calcium-induced Ins(1,4,5)P3 to 31% By contrast, the time- dependent restoration of intracellular calcium was similar under both conditions The gradual...
- 11
- 419
- 0
FUNDAMENTALS of KINEMATICS and DYNAMICS
... vector, the direction of another vector, and the directions of two other vectors, functionally related to the direction of the second vector, are to be found The loop-closure equation, after the ... property of the scalar multiplication is called the commutative law The result of the cross-product of two vectors is a vector perpendicular to the plane in which the original two vectors are ... DYNAMICS AS PART OF THE DESIGN PROCESS The role of kinematics is to ensure the functionality of the mechanism, while the role of dynamics is to verify the acceptability of induced forces in parts The...
- 306
- 395
- 0
Atomistic modeling of energetics and dynamics of diffusive and frictional phenomena in c60 graphene based systems
... defect must be taken into account to extract the diffusion coefficient from the data The measured diffusion coefficients could be dramatically different from the diffusion coefficients of a defect-free ... non-adiabatic coupling can be characterized by a simple friction coefficient η [91], where η is the kinetic friction coefficient, which indicates the rate of energy exchange between the adsorbate and the ... addition, the complexity of molecular surface diffusion raises questions of applicability of conventional theories of atomic surface diffusion, because these theories not take the effect of admolecule...
- 143
- 456
- 0
Study of pharmacokinetics of prenylflavonoids and dynamics of estrogen action in sera following ingestion of epimedium using validated, ultra sensitive cell based bioassays
... was added to MCF-7 cells To study combinatorial effects (additive, antagonistic or synergistic) of test compounds in the presence of estradiol, increasing concentrations of the test compound were ... brevicornu extract contains compounds such as icariin, icariside I, icarside II, icaritin and desmethylicaritin and metabolism of these compounds, particularly, the glycosides, occurs upon the ... fitted as the fixed effects To adjust for sequence effects, each treatment effect was added to half the sequence effect and exponentiated to obtain the adjusted GMR of the AUC Adjustment for the endogenous...
- 35
- 288
- 0
Study of pharmacokinetics of prenylflavonoids and dynamics of estrogen action in sera following ingestion of epimedium using validated, ultra sensitive cell based bioassays 2
... significance of this small increase is uncertain because this increase was due to the relatively large relative contribution of the 24 h timepoint to the AUC calculations There was a trend, not reaching ... sensitivity towards estrogenic ligands of the assay was ascertained by determining the detection limit, which was the concentration of the ligand that induced a luciferase activity equivalent to the ... Effects on cell proliferation of estrogen-induced of MCF-7 breast cancer cells by Epimedium prenylflavonoids MCF-7 breast cancer cells are incubated with increasing doses of icariin (A), icariside...
- 103
- 362
- 0
Study of pharmacokinetics of prenylflavonoids and dynamics of estrogen action in sera following ingestion of epimedium using validated, ultra sensitive cell based bioassays 4
... prevents the required docking to the receptor site and increases the molecules’ hydrophilicity Prenylation at the 8-position of the flavonoid backbone was observed to lead to an enhancement of estrogenicity ... suggesting that estrone contributed twice as much to ERβ activity in subjects’ sera Estrone can induce steroid receptor coactivator-1 recruitment to ERβ with much higher efficiency than for ERα (Margeat ... higher incremental mean estrone AUC compared to the 72% increase observed with estradiol The higher concentrations of estrone, plus the distinct affinity of the estrone–ERβ complex for coactivator...
- 29
- 192
- 0
Study of pharmacokinetics of prenylflavonoids and dynamics of estrogen action in sera following ingestion of epimedium using validated, ultra sensitive cell based bioassays 5
... osteoprotegerin In this case, osteoprotegerin can act as a decoy receptor for receptor activator of nuclear factor-kappa B ligand which then neutralizes its function in osteoclastogenesis Hesperetin, ... result of such differences in starting composition of constituents, the bioavailability of Epimedium compounds cannot be accurately ascertained from the results from both studies The duration of ... the expression of receptor activator of nuclear factorkappa B with no change in osteoprotegerin expression (Trzeciakiewicz et al., 2010) Hesperetin-7-O-glucuronide may be able to limit the activation...
- 15
- 231
- 0
Study of pharmacokinetics of prenylflavonoids and dynamics of estrogen action in sera following ingestion of epimedium using validated, ultra sensitive cell based bioassays 6
... activators of the aryl hydrocarbon receptor Chem Res Toxicol 21(1):102–16 Nichenametla, S N., T G Taruscio, D L Barney and J H Exon 2006 A review of the effects and mechanisms of polyphenolics ... T., Besson, C. , Manach, C. , Scalbert, A and Remesy, C 2006 The bioavailability of polyphenols is highly governed by the capacity of the intestine and of the liver to secrete conjugated metabolites ... liquid chromatography tandem mass spectrometry J Chromatogr B Analyt Technol Biomed Life Sci 860:166–172 Gruber, C. J., Tschugguel, W., Schneeberger, C and Huber, J .C 2002 Production and actions of...
- 16
- 311
- 0
Application of formal and dynamic equivalence to the translation of bị and được into english
... several common features The first common characteristic is the grammatical function between the subject and the object in which the object in the active sentence turns into the grammatical subject ... be concluded that the essence of dynamic equivalence is the receptor's response, in Nida's own term, "the degree to which the receptors of the message in the receptor language respond to it in ... so he cautions the translator not to easily change the form and asks them to achieve as much formal correspondence as possible, which marks a shift from total neglect of form to attaching certain...
- 62
- 520
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25