decide on a ranking scheme for each source stressor and habitat to allow the calculation of relative risk to the assessment endpoints
Regional Scale Ecological Risk Assessment - Chapter 2 potx
... endpoints Decide on a ranking scheme to allow the calculation of relative risk to the assessment endpoints Calculate the relative risks Evaluate uncertainty and sensitivity analysis of the relative rankings ... Break the map into regions based upon a combination of management goals, sources, and habitats Make a conceptual model that links sources of stressors to the receptors and to the assessment endpoints ... the management goals are then placed into a spatial context with the appropriate sources and habitats Step Make a Map Include Potential Sources and Habitats Relevant to the Management Goals As...
- 25
- 249
- 0
Tài liệu Exporting the Results of a Query to an Array pdf
... from the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the ... Object[][] tableArray = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and ... = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection of rows in the...
- 5
- 309
- 0
Báo cáo hóa học: "Clinically important improvement in the WOMAC and predictor factors for response to non-specific non-steroidal anti-inflammatory drugs in osteoarthritic patients: a prospective study" docx
... Email: sanae.alioualla@yahoo.fr Redouane Abouqal,Aff2 Email: abouqal@invivo.edu Najia Hajjaj-Hassouni,Aff1 Aff2 Email: n.hajjaj@medramo.ac.ma Aff1 Laboratory of Information and Research on Bone ... fadouaallali@yahoo.fr Latifa Tahiri,Aff1 Email: latifatahiri@yahoo.fr Hamza Khazzani,Aff1 Email: hamzakhazzani@yahoo.fr Leila El Mansouri,Aff1 Email: la_mansouri1@yahoo.fr Sanae Ali Ou Alla,Aff1 ... used Bonferroni adjustment for each two samples categories (womac and transition scale), (womac and both transition scale and womac), (transition scale and both transition scale and womac) Factors...
- 22
- 392
- 0
The Future of Justification: A Response to N. T. Wright pptx
... historical and systematic theology may control and distort the way one reads the Bible But we don’t hear as often the caution that the methods and categories of biblical theology can the same Neither ... have been saved without hearing the language of justification The same is true with regard to the words and realities of “regeneration” and “propitiation” and “redemption” and “reconciliation” ... strange human creatures The church and the academy both urgently need a new generation of teachers and preachers who will give themselves totally to the delighted study of the text and allow themselves...
- 240
- 1,101
- 0
Báo cáo khoa học: "A Response to the Need for Summary Responses" pdf
... frame corresponds to an attribute in the relations in the database In addition to a description of the attributes, these frames indicate the nature and range of the attribute's potential values ... The Knowledge Base The knowledge base incorporates subjective perceptions of the user as to the nature and contents of the database It consists of two types of frames - the relation and the attribute ... management system are to have the properties and constraints normally associated with human dialogue Interactions with traditional database management systems lack the "intelligence" and elegance...
- 5
- 430
- 0
báo cáo hóa học:" A decade of modelling research yields considerable evidence for the importance of concurrency: a response to Sawers and Stillwaggon" potx
... Acknowledgements The author thanks Aditya Khanna, Susan Cassels and the two anonymous reviewers for their valuable feedback and assistance with the manuscript Authors’ contributions SMG is responsible for all ... behavioural scenarios for various sub-Saharan African populations Sawers and Stillwaggon’s argument that the concurrency models of Morris and Kretzschmar only find an effect because of absurd parameters ... so they were in general not concerned with richly parameterizing their model with behavioural and biological data in all of the ways that Sawers and Stillwaggon outline as necessary for a realistic...
- 7
- 459
- 0
Báo cáo y học: "Decreased metalloproteinase production as a response to mechanical pressure in human cartilage: a mechanism for homeostatic regulatio" pps
... cartilage Ratio II collagen in OF and OA cartilage of aggrecan to type II collagen in the cartilage matrix of OA and OF femoral heads and comparison between areas (SP and IP) Aggrecan and type ... the ratio of aggrecan to type II collagen was determined by ELISA This ratio allows normalisation of data and elimination of variability due to cartilage quality, cartilage wet weight, and experimental ... degradation of the matrix, cell death, and total loss of cartilage integrity Matrix metalloproteinases (MMPs) are involved in the degradation of the components of the cartilage matrix Among MMPs,...
- 11
- 520
- 0
Báo cáo y học: "Collagen-induced arthritis in C57BL/6 mice is associated with a robust and sustained T-cell response to type II collagen" pot
... 30:1568-1575 Kai H, Shibuya K, Wang Y, Kameta H, Kameyama T, TaharaHanaoka S, Miyamoto A, Honda S, Matsumoto I, Koyama A, et al.: Critical role of M tuberculosis for dendritic cell maturation to induce ... this hypothesis However, the mycobacterial component of CFA provides many factors that are able to break tolerance via activation of Toll-like receptors The therapeutic profile of CIA in the B6 ... was similar to that of RA, with a therapeutic action of methotrexate at a dose comparable to human therapy This is in contrast to CIA in DBA/1 mice, in which methotrexate had no effect One of...
- 8
- 372
- 0
Báo cáo y học: "Differences between children and adolescents in treatment response to atomoxetine and the correlation between health-related quality of life and Attention Deficit/Hyperactivity Disorder core symptoms: Meta-analysis of five atomoxetine tria
... understand the implications for the individual as they get older and to evaluate medication effects with respect to age We therefore conducted a meta-analysis all atomoxetine clinical trials measuring ... statistics unadjusted for study Group comparisons at baseline were based on two-way analysis of variance (ANOVA) using the terms age and study for continuous variables and based on the Cochran-MantelHaenszel ... who had been randomized, had a baseline observation, and at least one postbaseline observation The last observation was the one reported Wehmeier et al Child and Adolescent Psychiatry and Mental...
- 15
- 739
- 0
INVESTING IN REPRODUCTIVE HEALTH TO ACHIEVE DEVELOPMENT GOALS pptx
... incidence of unsafe abortion, which conGoal 6: Combat HIV/AIDS, Malaria, and tributes to maternal disabilities and deaths Other Diseases In addition, family planning allows mothers The MENA region has ... likely to drop out of school.13 And smaller family sizes mean more family and national resources are available for each child Goal 2: Achieve Universal Primary Education An average of 85 percent of ... developed to monitor progress in these areas Having easy access to affordable and quality reproductive health information and services is Completed secondary fundamental to achieving Goal of the MDGs...
- 8
- 416
- 0
A Guide to Clinical Management and Public Health Response for Hand, Foot and Mouth Disease (HFMD) doc
... recommendations developed in the areas of: surveillance, epidemiology and burden of disease; characterization of etiological agents and A Guide to Clinical Management and Public Health Response for Hand, ... neuronophagia, perivascular cuffing, focal oedema and infiltration of inflammatory cells Viral cytolysis appears to be an important mechanism for neuronal damage The most severe inflammation is ... tachycardia, tachypnea, hypertension and hyperglycemia, are at risk of rapid progression to cardiopulmonary failure (13, 18) Abnormal heart rate variability (19) (an indicator for ANS dysregulation) and...
- 71
- 774
- 0
A guide to project management Frank Heyworth potx
... co-ordinators The 32 member states of the Enlarged Partial Agreement of the ECML are: Albania, Andorra, Armenia, Austria, Bosnia and Herzegovina, Bulgaria, Croatia, Cyprus, Czech Republic, Estonia, ... need to calculate (a) the average cost of travel (b) the average cost of overnight accommodation and (c) fix a sum for a daily meals allowance Communications The costs of phones, letters and faxes ... overall role is the implementation of language policies and the promotion of innovations in the field of teaching and learning modern languages The publications are the results of research and...
- 48
- 513
- 0
Báo cáo y học: "Role of Genetic Polymorphisms in Therapeutic Response to Anti-Asthma Therapy" pot
... investigated the genetic contribution to the variation in response to ICS therapy in asthma by assessing the association of change in lung function from candidate genes crucial to the biologic actions ... literature regarding potential phenotypic and genotypic indicators of response to therapy because one or the combination of both of these tools will likely be a clue to a patient’s response to therapy ... beclomethasone by assessing improvement in asthma control days as a surrogate to response.2 Although the authors demonstrated significant concordance in response (89%), they also demonstrated variability...
- 3
- 387
- 0
Báo cáo y học: "Blood autoantibody and cytokine profiles predict response to anti-tumor necrosis factor therapy in rheumatoid arthriti" pps
... application of a multi-step proteomics approach using RA antigen arrays and cytokine arrays to discover and validate a multivariable biomarker for prediction of response to the anti-TNF therapy ... USA) Data analysis The data analysis was performed using significance analysis of microarrays (SAM) (version 1.21) and prediction analysis of microarrays (PAM) (version 1.23), and the hierarchical ... design and coordination WH drafted the manuscript All authors read and approved the final manuscript Additional files The following Additional files are available online: Additional data file...
- 13
- 299
- 0
báo cáo khoa học: "Evaluation of HER2 and p53 expression in predicting response to docetaxel-based first-line chemotherapy in advanced breast cancer" docx
... response to docetaxel-based first-line chemotherapy in advanced breast cancer Andrea Camerini1*, Sara Donati1, Paolo Viacava2, Olimpia Siclari1, Cheti Puccetti1, Gianna Tartarelli1, Chiara Valsuani1, ... Viareggio and Istituto Toscano Tumori - Versilia Hospital, Lido di Camaiore, Italy 3Pathology Division, AUSL Massa-Carrara and Istituto Toscano Tumori, Carrara, Italy Authors’ contributions AC: ... statistical analysis, data interpretation and paper writing; SD: data collection and interpretation; PV: data collection, immunohistochemistry performance and interpretation; OS: data Page of...
- 9
- 282
- 0
Báo cáo y học: "Role of TRPV3 in immune response to development of dermatitis" doc
... TGGCTTCCCTTTCTCAGACA GGCTACCCCCTCTCAGACAT CCAGAACAACGCAAGAAGACT TGAGAAGTTCCAATCCAGTCG TAAACGAAACAGTTCCAAGGC ATAGATGATTCAGGGATGCCC CGCAGCAAGTCTCTTATGGAA GCGACACAGCCACCTATCTC TTCATCCTAAGCACGGAGAAG TTCCCATCAGTCATCCCAAC ... ACGGTGCCCAGTCGTTTTAT ACACGGGTCACTGATACGGA AGTGTCCTTCAAACTCACCTT ATGGACAATCAGACTGCCTCA AGATAAAGGAAACCTGCCCAG GGATTCCTACCCAGCAGATTC GAAGGCTATGATGCGTCTCG AAAGGATACAGGGTCTCACGG TGGCTTCCCTTTCTCAGACA ... TTCCCATCAGTCATCCCAAC TCACTCTGAAAATCCAACCCA GCATCCTGGAAATCCTATCCT GGACAAGTTTCCAATCAGCCG AAAATGCCCTGCTAAGAAACC CAGCCTGGGAATCAGAACG BV1S 1A1 , BV2S1 BV3S 1A1 , BV4S1 BV5S1 BV2S2 BV6S 1A1 , BV7S1 BV8S1 BV8S 2A1 , 2,...
- 10
- 359
- 0
Báo cáo sinh học: " Correlations of genetic resistance of chickens to Marek’s disease viruses with vaccination protection and in vivo response to" pptx
... Statistical analyses Spearman’s rank and Pearson’s product-moment correlation between resistance to the BC-1 and RB-1B viruses and PHA response were calculated on the basis of genetic group means ... Spearman’s rank and Pearson’s productmoment correlations (table III) the correlations for males and females separately, as well as for sexes combined were all high and significant, although correlations ... by vaccination (fig 2) was based on only genetic groups but should have a broad validity for the virus strain and vaccine type tested, as the resistance of the nonvaccinated groups practically...
- 13
- 205
- 0
Ethnic differences in cardiovascular response to stress role of trait anger, sex and migrant status
... reactivity across racial groups, Kelsey, Alpert, Paterson and Barnard (2000) evaluated BP, HR and impedance cardiographic measures of PEP and TPR in healthy African American and Caucasian American ... reactivity to a video game challenge and to a star tracing task was also significantly predictive of subsequent ambulatory HR in African Americans and diastolic reactivity to star tracing was associated ... social conditions of ethnic groups The health behaviors and other risk factors for CHD should therefore be understood within the personal and social contexts that facilitate their initiation and...
- 210
- 267
- 0
Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt
... included the insects D melanogaster (AAB60217), A gambiae (EAA06264), A aegypti (AAK15810), S invicta (AAP92450) and P americana (BAC02725), and the vertebrates Anguila japonica (BAB64337), Conger ... developmental stages using the General Elute Mammalian TotalRNA kit (Sigma, Madrid, Spain) A 300 ng portion of each RNA extraction was DNAse treated (Promega, Madison, WI, USA) and reverse transcribed ... function analyses in nondrosophilid species For example, RNAi has been used in the cockroach P americana to analyze the function of the homeotic gene engrailed in relation to the control of axon pathfinding...
- 11
- 414
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25