cross tabulations between the potential predictors and outcome at the 4th visit
Báo cáo y học: "he Nordic Subpopulation Research Programme: prediction of treatment outcome in patients with low back pain treated by chiropractors - does the psychological profile matter" pps
... obtained at the 4th visit (pain intensity past 24 hrs at 4th visit and outcome at 4th visit) The outcome variable at the 4th visit was obtained from the question "Improvement? (compared to the 1st visit) : ... at the 4th visit i Cross- tabulations between the potential predictors and outcome at the 4th visit As can be seen in Table 6, one social factor (fee subsidization), and four health-related factors ... if they had none of these findings to 36% if they had or of them (Table 7, Table and Table 9) Results at months i Cross- tabulations between the potential predictors and outcome at3 months The...
- 13
- 354
- 0
Báo cáo y học: "Correlation between the AKI classification and outcome" pdf
... to the ICU and compared them with AKI as defined by the RIFLE classification They concluded that the AKI criteria did not improve the sensitivity and predictive ability of classifying AKI in the ... hours in the ICU [6] The aim of our study was to apply the AKI criteria to a large ICU population during the entire stay in the ICU and to evaluate the impact of AKI in the context of other risk ... (ESRF) and three patients with incomplete data The remaining 22,303 patients were included in the study Data analysis The AKI criteria were applied to 22,303 patients Due to a lack of data on...
- 10
- 391
- 0
báo cáo hóa học: " Evaluation of adaptation to visually induced motion sickness based on the maximum cross-correlation between pulse transmission time and heart rate" docx
... in the ρmax between TS-down and TS-up groups at the middle parts of the video, Part-2 and Part-3 This result indicates that the repetition of watching made some subjects more sensitive to the ... physiological data such as heart rate and blood pressure [12-14] A previous study [14] showed that the physiological index, ρmax, defined as the maximum cross- correlation coefficient between heart rate and ... because there is a possibility that the number of repetitions in this experiment was too small for adaptation, and should investigate adaptation in the case of watching other video images and VR...
- 6
- 534
- 0
Tài liệu Mapping Table and Column Names Between the Data Source and DataSet docx
... Table2, and so on You can use table mapping to rename tables created within the DataSet to match the table names in the data source or to map the tables returned from a batch query to DataTable ... property These objects map the name of a table in the data source to a DataTable with different name in the DataSet When a batch query is used to fill multiple tables within a DataSet, the table ... information from a data source Like the Fill( ) method, the Update( ) method always uses mapping information (if present) when submitting DataSet changes back to the data source In the solution, the...
- 3
- 445
- 0
Tài liệu Báo cáo khoa học: Basis of recognition between the NarJ chaperone and the N-terminus of the NarG subunit from Escherichia coli nitrate reductase pdf
... loading and protein folding are complete Accordingly, we hypothesize that the protonated state of the chaperone initiates this cycle, whereas the deprotonated state occurs upon completion of the maturation ... investigate the kinetic parameters of the interaction (on rate constant kon and off rate constant koff) between NarJ and the NarG(1–15) peptide Taking into account the existence of two subpopulations ... complex formation indicated a slow exchange on the NMR timescale between the free and the bound forms for NarJT These results and the higher excess partial molar heat capacity of the complex observed...
- 10
- 685
- 0
Báo cáo Y học: Inhibition of the SERCA Ca21 pumps by curcumin Curcumin putatively stabilizes the interaction between the nucleotide-binding and phosphorylation domains in the absence of ATP pot
... membrane to the luminal side and are of low affinity Furthermore, in the E1 conformational state, the ATPase can be phosphorylated by ATP, which drives the translocation process From the data presented ... in the absence of ATP, curcumin is then able to bind to the ATPase (possibly at the hinge region) locking the two domains together and therefore precluding ATP binding (i.e inhibiting the ATPase ... affecting the interaction of ATP binding to the ATPase, this was directly measured using [32P]ATP in the absence of Ca2þ (Fig 4A) The data showed that the amount of ATP bound to the ATPase was...
- 10
- 594
- 0
Báo cáo khoa học: "Augmented Dependency Grammer: A Simple Interface between the Grammer Rule and the Knowledge" pptx
... can be found among the words (wl and w2) syntactically dependent on the word, w3 That is the word, wl Furthermore, the crossing of a2 and a3 violates the non-crossing condition The context stack ... If the focused word (called FOCUS) and the word on the top of the push-down stack (called Pd-TOP) have the FEATUREs specified by the rule, a new HEAD with the derived FEATUREs is created by the ... bridge the gap between both kinds of dependencies When Legato creates a new HEAD from Pd-TOP and HEAD, the context associated with Pd-TOP is stacked up onto the context stack in the new HEAD At the...
- 7
- 373
- 0
Báo cáo Y học: Amino acids 3–13 and amino acids in and flanking the 23FxxLF27 motif modulate the interaction between the N-terminal and ligand-binding domain of the androgen receptor pdf
... 5¢-AATTCGGGGCCCGGGTTCTGGATCACTTCGCGCACGCTCTGGAACAGATTCTG-3¢ 5¢-CGGAGCAGCTGCTTAAGCCGGGG-3¢ 5¢-AAGCTTCTGCAGGTCGACTCTAGG-3¢ 5¢-GATCCATATCGATAAGCTTAGATCTGAATTCA-3¢ 5¢-AATTCAGATCTAAGCTTATCGATATG-3¢ ... expressivity and mutation databases: the androgen receptor gene mutations database Hum Mutat 17, 382–388 17 Langley, E., Zhou, Z.X & Wilson, E.M (1995) Evidence for an anti-parallel orientation of the ... interaction and the transactivating function of the AR prostate cancer mutant T877A can be induced by natural low affinity ligands like progesterone or E2 or the AR antagonist cyproterone acetate [18]...
- 12
- 597
- 0
Báo cáo sinh học: " Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pdf
... found in the Das G1 primer, 9T1-1, at the 5' end (Fig 2) Due to these mismatches, the Das G1 primer failed to detect most (75%) of the G1 strains Since, the primer set had perfect matches at the 3' ... TCTTGTCAAAGCAAATAATA Das primer, 9T1-1 5’ CAAGTACTCAAATCAGTGATGG Target sequence 3’ CAAGTACTCAAATCAATGATGG Gouvea primer, aBT1 Figure Nucleotide mismatches in the primers Nucleotide mismatches in the primers ... (Qiagen/Westburg, Leusden, The Netherlands) was used according to the manufacturer's instructions for the extraction of rotavirus RNA from the stool samples Because of the natural variation in the rotaviral...
- 5
- 389
- 0
Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx
... three out of the four mutations by ■, and three mutations plus others at the primer binding site by ᮀ The open branches indicate one or two mutations at the primer binding site The lineages are ... showing the four lineages described in genotype G1 of rotaviruses The strains having the four mutations reported by Rahman and his colleagues are indicated by ●; the four mutations plus others at the ... was reported that the accumulation of point mutations in VP4 and VP7 genes was the main cause of the failure of the G or P-typing of rotavirus strains [7,8,12,16-21] At least, there are four...
- 4
- 329
- 0
báo cáo hóa học:" Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pptx
... found in the Das G1 primer, 9T1-1, at the 5' end (Fig 2) Due to these mismatches, the Das G1 primer failed to detect most (75%) of the G1 strains Since, the primer set had perfect matches at the 3' ... TCTTGTCAAAGCAAATAATA Das primer, 9T1-1 5’ CAAGTACTCAAATCAGTGATGG Target sequence 3’ CAAGTACTCAAATCAATGATGG Gouvea primer, aBT1 Figure Nucleotide mismatches in the primers Nucleotide mismatches in the primers ... (Qiagen/Westburg, Leusden, The Netherlands) was used according to the manufacturer's instructions for the extraction of rotavirus RNA from the stool samples Because of the natural variation in the rotaviral...
- 5
- 355
- 0
Báo cáo hóa học: " Nanoliposomes for encapsulation and delivery of the potential antitumoral methyl 6-methoxy-3-(4methoxyphenyl)-1H-indole-2-carboxylate" doc
... liposomes M-JRPQ and PMF supervised the organic synthesis and compound characterization and participated in the draft of the manuscript LAVS was responsible for the antitumoral evaluation of the compound ... conceived the study, were responsible for the interpretation of results, and drafted the manuscript ASA carried out the liposome preparation, the DLS and zeta potential measurements and dialysis ... membrane and incorporation in the membrane of the acceptor liposomes The phospholipids DPPC and DPPG are the main components of biological membranes and are both in the gel phase at room temperature...
- 6
- 323
- 0
Báo cáo hóa học: " Research Article Representation of Multivariate Functions via the Potential Theory and Applications to Inequalities'''' docx
... calculation shows that the right-hand side of 5.14 for fp,y equals the above LHS ii The first identity of 5.15 follows from Theorem 5.1, while the second follows from Theorem 1.3 with Ω BR a and ... for the absolute value of the difference D f; x : f x − b b−a f t dt, x ∈ a, b 5.3 a The obtained results have been applied in approximation theory, numerical integration, information theory, and ... which at any point x ∈ ∂Ω coincides with that of the exterior normal ν, while its intensity is equal to h x The double-layer potential is well defined in RN and it satisfies the Laplace equation...
- 15
- 267
- 0
Báo cáo hóa học: " Research Article Representation of Multivariate Functions via the Potential Theory and Applications to Inequalities" ppt
... calculation shows that the right-hand side of 5.14 for fp,y equals the above LHS ii The first identity of 5.15 follows from Theorem 5.1, while the second follows from Theorem 1.3 with Ω BR a and ... for the absolute value of the difference D f; x : f x − b b−a f t dt, x ∈ a, b 5.3 a The obtained results have been applied in approximation theory, numerical integration, information theory, and ... which at any point x ∈ ∂Ω coincides with that of the exterior normal ν, while its intensity is equal to h x The double-layer potential is well defined in RN and it satisfies the Laplace equation...
- 15
- 288
- 0
Báo cáo sinh học: "A balancing act between the X chromosome and the autosomes" ppsx
... modulate the expression of the X chromosome in the soma and germ cells Further studies to elucidate how each species achieves dosage compensation between the X chromosomes and the autosomes in the ... et al [8] is the fact that the X chromosomes in the Drosophila germline are upregulated to match the expression of the autosomes The molecular mechanism of dosage compensation in these cells is ... related to the use of common pathways between sex determination and dosage compensation in this species Interestingly, the expression of the X chromosome seems to be slightly higher than that...
- 3
- 315
- 0
báo cáo khoa học: "Genetic disequilibria between the α β-, κ-casein -, S1 and the β-lactoglobulin loci of the Bavarian Brown and Bavarian Simmental cattle" docx
... represents the disequilibrium between loci i and j and p q the gene , ; j ij r denotes the gametic correlation and N equals the number at the loci of gametes in the sample In our samples the rare ... differentiation between the A’, Nand A alleles at the f3-Cn locus which however did not prevent the recognition of the disequilibria between the f3-Cn and the a,,-Cn loci In our tBV sample the disequilibrium ... 1970), that between casein loci and , ARSEN the lactoglobulin locus 1/2 It appears to be of interest to investigate the status of linkage equilibria among casein loci and between these and the [3-lactoglobulin...
- 9
- 300
- 0
Báo cáo y học: " The interaction between the PARP10 protein and the NS1 protein of H5N1 AIV and its effect on virus replication" pot
... after the infection, and no significant increase in the supernatant and in the cells afterwards, indicating that H5N1 AIV replication reached the peak in BHK21 cells at 48 h (Figure 6) Therefore, ... florescent, indicating that NS1 could change the localization of PARP10 (Figure 3b) The localization result in NIH3T3 cells was same to that in A549 cells So the results illustrated that NS1 could ... buffer (Gibico), ml serum-free medium and 5 × 105 pfu H5N1 AIV were added, and then lightly oscillated to mix up The plate was incubated at 37°C for h, and then cells were rinsed twice with Hanks...
- 28
- 391
- 0
Báo cáo y học: "Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis" doc
... explanation for the discrepancy between the in vitro and in vivo settings might be that the intravenously injected MSCs not reach the spleen and lymph nodes and are therefore unable to inhibit the ... unstimulated or stimulated MSCs (data not shown) These data indicate that IFN-g acts synergistically with IL-17 to upregulate expression of PD-L1, iNOS, and COX-2 in MSCs, making these molecules candidate ... PBS in the left ear DTH response was calculated as the percentage swelling (the difference between the increase of thickness of the right ear and the left ear, divided by the thickness of the left...
- 11
- 464
- 0
Báo cáo y học: " Mechanical ventilation in the ICU- is there a gap between the time available and time used for nurse-led weaning?" pot
... store our data, was in charge of the data collection, and contributed to authoring the manuscript Both authors initiated the study OBN translated the data into SPSS and generated the tables HML ... also facilitate teamwork and interprofessional communication and may therefore increase the success of weaning [8] On the other hand, there are significant barriers to the use of such standardised ... basis to motivate and stimulate the whole team This method is in line with that proposed by Kassean and Jagoo [23] who recommend the creation of a climate that encourages open communication to overcome...
- 8
- 338
- 0
Báo cáo y học: "Genetic subtraction profiling identifies genes essential for Arabidopsis reproduction and reveals interaction between the female gametophyte and the maternal sporophyte" pot
... sporophytic candidate genes), transcriptional regulation (10% and 9%), signaling (7% and 6%), translation and protein fate (5% each), RNA synthesis and modification (3% and 1%), and cell cycle and chromosome ... likely that these mutants carry a similar translocation and, therefore, we did not analyze them further These findings demonstrate that among the T-DNA insertation lines available, a rather high ... size for both the gametophytic and sporophytic datasets, we report all the data across the three methods (Additional data file 6) This approach is validated by the fact that candidate genes found...
- 21
- 254
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25