creating altering and dropping tables with t sql
Designing and Implementing Databases with Microsoft SQL Server 2000 Enterprise Edition
... not UPDATE STATISTICS by itself but can turn on the automatic UPDATE STATISTICS procedure This update is performed by the task that detected that the statistics needed to be updated The update ... constraint between the two tables, and rows must be deleted from both tables A simple DELETE statement cannot accomplish this Two DELETE statements must be used; first one DELETE statement on the Parts ... packages that export the data from the database and place the data into tab-delimited text files Create an application that uses SQL_ DMO to extract the data from the database and transform the data...
- 196
- 645
- 1
beginning t-sql with microsoft sql server 2005 and 2008
... stored With a varchar data type on a table column, the data is stored physically in the row with the rest of the data With a text data type, the data is stored separately from the actual row and ... how the INSERT, UPDATE, and DELETE statements interact with the relational database engine and transaction log to lock and modify data rows with guaranteed consistency You will not only learn to ... language and data management systems, and then continue with the SQL Server product fundamentals This first section teaches the essentials of the SQL Server product architecture and relational database...
- 675
- 772
- 0
Stored Procedure and Advanced T-SQL
... Vi t Stored Procedure T n thông tin Stored Procedure t o chứa SysObjects table phần text chứa SysComments table Vì Stored Procedure xem object nên ta dùng lệnh CREATE, ALTER, DROP để t o mới, thay ... smallint BEGIN TRANSACTION If not Exists(SELECT CustomerID FROM Customers WHERE [Name]=@CustomerName) This is a new customer Insert this customer to the database BEGIN SET @CustomerID= (SELECT Max(CustomerID) ... VALUES(@OrderID,@ProductName,@CustomerID) SELECT COMMIT END END Print @Result Return insert it now INTO [Orders] @Result=0 TRANSACTION Ðể t o stored procedure ta dùng lệnh CREATE PROCEDURE theo sau t n (nếu temporary stored...
- 10
- 1,023
- 3
mapping your objects to database tables with linq to sql
... Tables with LINQ to SQL Tasks Detailed Steps } … } Note: Notice that you not set the value of the _Orders object, but rather call its Assign method to create the proper assignment The EntitySet type ... Mapping Your Objects to Database Tables with LINQ to SQL Table of Contents Mapping Your Objects to Database Tables with LINQ to SQL Exercise Creating Your First LINQ TO SQL Application ... Database Tables with LINQ to SQL Tasks Detailed Steps physically contain all the rows from the underlying table but acts as a typed proxy for the table Note: The next step retrieves data from the database...
- 29
- 434
- 0
Stored Procedure and Advance T-SQL
... vào commit transaction với k t trả =0 T ơng t người customer t n (sau chữ else đầu tiên) ta việc insert order giống Trong trường hợp kể ta in k t return Ví dụ mang t nh học hỏi thực t database ... smallint BEGIN TRANSACTION If not Exists(SELECT CustomerID FROM Customers WHERE [Name]=@CustomerName) This is a new customer Insert this customer to the database BEGIN SET @CustomerID= (SELECT Max(CustomerID) ... (nếu temporary stored procedure thêm dấu # trước t n procedure Nếu muốn encrypt dùng WITH ENCRYPTION trước chữ AS) input ouput parameters Nếu output thêm keyword OUTPUT đằng sau parameter Ta cho...
- 8
- 409
- 0
Tài liệu Use Variables and Functions in T-SQL pptx
... the "Technique" section, this code then assigns the routine to the Text property of the Label called lblSQLString It then creates a data adapter using the string and fills the dtResults DataTable ... the controls listed in Table 6.2 and seen in Figure 6.3 with the following properties set Table 6.2 Control Property Settings for This How-To Object Property Setting Label Text SQL Statement Label ... How-To calls the DateDiff() function As with Visual Basic's DateDiff() function, this function takes two dates, and based on the interval requested, it returns the difference between the two To...
- 4
- 548
- 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt
... TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third ... encoding the mature protein (5¢ primer, 5¢-CATGCCATGGCCAGTAGTCAGCCTGACCCTACT CCAG-3¢; 3¢ primer, 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen ... properties with the staphylococcal enterotoxins SEB and SEC than with other streptococcal SAgs [19] Cellular proliferation studies show disagreement about which TCR bearing T- cell subsets are expanded...
- 9
- 485
- 0
Creating and Managing Tables potx
... TIMESTAMP[(fractional_seconds_precision)] WITH TIME ZONE 9-15 Copyright © Oracle Corporation, 2001 All rights reserved TIMESTAMP WITH LOCAL TIME Data Type • TIMESTAMP WITH LOCAL TIME ZONE is another variant of TIMESTAMP that includes ... extension of the DATE data type • It stores the year, month, and day of the DATE data type, plus hour, minute, and second values as well as the fractional second value • The TIMESTAMP data type is ... Enhancements have been made to time zones and local time zone Data Type Description TIMESTAMP Date with fractional seconds INTERVAL YEAR TO MONTH Stored as an interval of years and months INTERVAL...
- 33
- 404
- 0
electronic devices and amplifier circuits with matlab applications - steven t. karris
... external circuit consists of electrons moving out of the negative terminal of the battery and into the positive terminal of the battery Hole flow, on the other hand, only exists within the material ... crystal that has been thermally agitated we have two types of current movement; the free electron movement and the hole movement The movement of holes can be best illustrated with the arrangement ... applications, the Zener, Schottky, tunnel, and varactor diodes, and optoelectronics devices Chapters and are devoted to bipolar junction transistors and FETs respectively, and many examples with detailed...
- 629
- 1,309
- 0
signals and systems with matlab computing and simulink modeling - steven t. karris
... ∞ < t < +∞ To this, it is convenient to divide the time interval into two parts, – ∞ < t < , and < t < ∞ For the time interval – ∞ < t < , the switch is open and therefore, the output voltage ... property states that e ∞ t ∫– ∞ t e t δ ( t – ) dt = t e t= 2 = 4e –2 ∞ ∫–∞ f ( t )δ ( t – α ) dt = f ( α ) Thus, = 0.54 f We recall that the sampling property for the doublet states that f ( t ... )δ ( t ) = f ( )δ ( t ) • The sifting property of the delta function states that ∞ ∫–∞ f ( t )δ ( t – α ) dt = f(α) • The sampling property of the doublet function δ' ( t ) states that f ( t )δ'...
- 651
- 470
- 0
báo cáo hóa học:" Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II) peptide-pulsed DCs" pot
... pulsed with class I epitope of hTERT, with or without class II epitopes This strategy has been used previously with melanoma-related antigen class I peptides to compare the activity of immature and ... taking systemic steroids, nor did they have any medical contraindication to enrolment Patients Ten patients (6 with prostate cancer, with malignant melanoma, with breast cancer and with lung cancer) ... Results are represented as mean (SD) Statistically significant SCC-4 cytotoxicity was observed with DCT and DCTI re-stimulated PBMCs compared with PBMCs restimulated without the class I peptides...
- 23
- 439
- 0
Learning Joomla 1.5 Extension Development Creating Modules, Components, and Plug-Ins with PHP pptx
... shows the Joomla! root with the administrator folder expanded: Notice that the administrator folder has a structure similar to the root folder It is important to differentiate between the two, ... component is not built to take this into account, it is possible that website administrators will lose their template and module selections To take advantage of the system, it is necessary to use the ... administrative functions into the front-end code This is an important distinction as the front end and back end are similar in structure [ 13 ] Getting Started with Component Development The following...
- 171
- 489
- 0
Báo cáo y học: "Reduced proportions of natural killer T cells are present in the relatives of lupus patients and are associated with autoimmunity" ppt
... important clues to the genesis of these conditions Competing interests The authors declare that they have no competing interests Authors' contributions JW participated in study design; coordinated ... compartment They also had increased CD4+ T- cell activation, with an increased proportion of recently activated CD69+CD4+ T cells Consistent with reports in the literature, lupus patients had ... recent study [38] found no significant difference between the proportion of cells detected by anti-Vα24 and anti-Vβ11 staining, and those observed after staining with CD1d tetramers loaded with the...
- 13
- 451
- 0
báo cáo khoa học: "Analysis of the expression pattern of the BCL11B gene and its relatives in patients with T-cell acute lymphoblastic leukemia" doc
... 5’-6FAM-TCACCCACGAAAGGCATCTGTCCCAAGCA-TAMRA probe b2Mf 5’-CTCGCGCTACTCTCTCTTTCT forward primer b2Mb 5’-TACATGTCTCGATCCCACTTAACTAT backward primer b2Mp 5’-6FAM-CTCACGTCATCCAGCAGAGAATGGAAAGTCA-TAMRA ... transcriptase Superscript II Kit (Invitrogen), according to the manufacturer’s instructions Real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) Quantitative detection of the ... primer SPP1 5’-TCAGGTCTGCGAAACTTCTTAG-3’ backward primer CREBBP 5’-CGGTTTCTCGGCGAATGAC-3’ forward primer CREBBP 5’-CATTTCCTATTCCTGGGTTGAT-3’ backward primer Figure Expression levels of the BCL11B...
- 7
- 410
- 0
Giới Thiệu Sơ Lược Về Transact SQL (T-SQL)
... Lệnh Alter sau cho phép ta thay đổi định nghĩa table thêm(hay b t) c t hay Constraint Trong ví dụ ta thêm c t ContactTitle vào table Importers USE Northwind ALTER TABLE Importers ADD ContactTitle ... INTO Territories VALUES (98101, 'Seattle', 2) Update USE Northwind UPDATE Territories SET TerritoryDescription = 'Downtown Seattle' WHERE TerritoryID = 98101 Delete USE Northwind DELETE FROM Territories ... parser, sau SQL Optimizer (m t phận quan trọng SQL Server) phân t ch t m cách thực thi (Execute Plan) t i ưu ví dụ cách nhanh t n t i nguyên máy sau SQL Server Engine thực thi trả k t Thực Thi nhóm...
- 6
- 779
- 5
Lập trình T SQL - slide
... Day T vi t t t hh Mi Ss Ms Dy Dd Giá trị 0-23 0-59 0-59 0-999 1-366 1-31 Database Design and Implementation with SQL Server / Session /30 of 36 Date Parts (tiếp…) Datepart T vi t t t Giá trị ... khóa GOTO bỏ qua tiến trình thực thi tiếp t c vị trí nhãn mệnh đề GOTO Cú pháp: GOTO nhãn Database Design and Implementation with SQL Server / Session /17 of 36 RETURN RETURN: Ta dùng RETURN lúc ... sau TSQL: Database Design and Implementation with SQL Server / Session /23 of 36 Các biến toàn cục Biến toàn cục SQL Server b t đầu ký t @ Ta truy xu t giá trị biến truy vấn SELECT đơn giản Database...
- 36
- 1,112
- 8
T-SQL Programming
... lệnh T- SQL để thay ký t c t Titleid t bảng Titles ‘ABB’ với điều kiện kiểu(type) ‘business’ Vi t câu T- SQL để hiển thị t n nhà xu t khác chữ thường 78 Database Design and Implementation with SQL ... Quantity > 100 Trả số lượng m t hàng yêu cầu có quantity > 100 SELECT MAX(Quantity * UnitPrice)As 'Largest Order' Database Design and Implementation with SQL Server T n Hàm Min (t n c t) Giá trị trả ... Avg (t n c t) Trả giá trị trung bình t p hợp giá trị c t Trả giá trị t ng trường ‘Quantity’ t bảng WidgetOrders SELECT AVG(UnitPrice * Quantity) As AveragePrice FROM WidgetOrders WHERE Continent...
- 20
- 2,814
- 7
Lập trình T - SQL và các quản lý bảo mật
... lệnh SQL Ví dụ, gán giá trị cho biến khai báo trước SET @Contact = 'Sales Manager' SELECT * FROM Customers WHERE contacttitle = @contact K t khối lệnh SQL hiển thị hình 8.5 Lập trình T- SQL , ... nghĩa giao t c t ờng minh Sử dụng BEGIN COMMIT TRANSACTION Câu lệnh BEGIN TRANSACTION đánh dấu điểm b t đầu giao t c COMMIT TRANSACTION đánh dấu k t thúc giao t c Chúng ta t ng giá trị UnitPrice ... GO CREATE TABLE [dbo].[Batch] ( [BatchNo] int NULL , [DateStarted] Datetime NULL , [NoOfStudentsEnrolled] [int] NULL , [MinimumNumberOfStudents] [int] NULL, [MaximumNumberOfStudents] [int] NULL,...
- 12
- 829
- 7
Báo cáo y học: "Effects of p-Synephrine alone and in Combination with Selected Bioflavonoids on Resting Metabolism, Blood Pressure, Heart Rate and Self-Reported Mood Changes"
... that measures oxygen consumption (VO2) to determine resting metabolic rate (RMR) In conjunction with the study, test-retest reliabilities of the instrument were measured on 41 subjects from test-retest ... heart-rate and RMR were determined Statistical Analyses ANOVAs were calculated between the groups’ baseline, ending and change scores for each treatment group in addition to Dunnett’s t- test between ... heart-rate and self-reports in the four treatment groups, the consistency of the effects of p-synephrine on metabolism in all treatment groups, and the increases in RMR in the treatment groups The...
- 7
- 641
- 0
Báo cáo y học: "Weight loss, leukopenia and thrombocytopenia associated with sustained virologic response to Hepatitis C treatmen"
... attributed to our supportive staff and follow-up system The potential interaction between psychiatric illness and its treatment with HCV therapy could not be assessed with our limited study This ... weight but did not achieve their baseline bodyweight In our study, patients with SVR had significantly lower WBC and platelet count at the end of treatment compared to those without SVR These ... factor for HCV treatment failure, and weight reduction was associated with treatment success (10, 20) However, other studies demonstrated that weight loss did not improve the treatment outcomes...
- 7
- 519
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25