conclusion a unified theoretical framework for plasticity in visual circuitry
Báo cáo hóa học: " A Theoretical Framework for Soft-Information-Based Synchronization in Iterative (Turbo) Receivers" ppt
... The same is done in [16] in combination with a suboptimal filter-based equalizer and in [17] for a coded CPM system In [18], channel gain, and delay estimation is performed in an uncoded CDMA system ... implementation, this means that at each EM iteration the turbo receiver has to reinitialize the extrinsic information, and then has to iterate until the soft information reaches a steady-state value, ... constellation is apparent, as can be found in [11] Note that, if one can a ord an increase in complexity, the above problem can be easily handled by evaluating the average value of the absolute...
- 13
- 375
- 0
Báo cáo khoa học: "A Computational Framework for Composition in Multiple Linguistic Domains" doc
... entry for -lH Jack Hoeksema and Richard D Janda 1988 Implications of process-morphology for categorial grammar In R T Oehrle, E Bach, and D Wheeler, editors, Categorial Grammars and Natural Language ... functions as a basis for grammatical analysis In R T Oehrle, E Bach, and D Wheeler, editors, Categorial Grammars and Natural Language Structures, D Reidel, Dordrecht, 1988 C Pollard and I A Sag 1994 ... m a t i o n S t r u c t u r e and Tactical Constraints Entries in the eategorial lexicon have tactical constraints, grammatical and semantic features, and phonological representation Similar...
- 3
- 339
- 0
Báo cáo Y học: A new conceptual framework for enzyme catalysis Hydrogen tunneling coupled to enzyme dynamics in flavoprotein and quinoprotein enzymes docx
... study Aromatic amine dehydrogenase (AADH), like MADH, is a TTQ-dependent amine oxidase AADH transfers electrons, derived from the deamination of primary amines (aromatic amines are generally preferred ... substrate benzylamine Again,aswithMADHandTSOX,anindicationasto whether H-transfer occurs classically or by quantum tunneling was gained by investigating the temperature dependence of the rates ... H-tunneling by a vibrationally assisted mechanism, although a Boltzman analysis suggests a very small population in anything other than the vibrational ground state An alternative explanation might...
- 7
- 359
- 0
A game theoretical model for collaborative protocols in selfish, tariff free, multi hop wireless networks
... routing Local state information is maintained at each node and can be assumed to be always available The local state information contains the cost metric of outgoing links, such as queuing delay, ... propagation delay and available bandwidth The collection of local state information of all nodes in the network forms the global state Unlike local state information, global state information takes ... information In the case when the players know all past moves, the game is said to have perfect information, and when only partial information is available it is said to have imperfect information...
- 143
- 1,029
- 0
Tài liệu A Leader’s Framework for Decision Making ppt
... David J Snowden and Mary E Boone In January 1993, a gunman murdered seven people in a fast-food restaurant in Palatine, a suburb of Chicago In his dual roles as an administrative executive and ... context, staying aware of danger signals, and avoiding inappropriate reactions, managers can lead effectively in a variety of situations THE CONTEXT’S CHARACTERISTICS SIMPLE Repeating patterns and consistent ... of each individual’s entrained thinking—or ego Working in unfamiliar environments can help leaders and experts approach decision making more creatively For instance, we put retail marketing professionals...
- 10
- 745
- 0
Tài liệu Báo cáo khoa học: "A Unified Graph Model for Sentence-based Opinion Retrieval" pdf
... between the opinion and its corresponding target, Avatar in A and com- 1368 fortable (o1) are also regarded as relevant opinion mistakenly, creating a false positive In reality comfortable (o1) describes ... required that large amount of training data and manual labeling Different from the above opinion retrieval approaches, our proposed graph-based model processes opinion retrieval in the granularity ... “the seats in IMAX”, which is an irrelevant opinion, and sentence A is a factual statement rather than an opinion statement (a) (b) Figure 2: Two kinds of information representation of opinion...
- 9
- 585
- 0
Tài liệu Báo cáo khoa học: "A Finite-Slate Parser for Use in Speech Recognition" pdf
... below, indicating the this way standard chart parsing techniques can be adopted to process starting point and ending point of each phrase in the input string allophonic and phonotactic constraints, ... P,ccall that a chart parser takes as input a sentence and a context-free Alternatively, the input sentence can be decomposed into [~'t][slzl In grammar and produces as output a chart like that ... constraint Nasal-cluster and place-assimilation are defined as: where many of the ~atures overlap m an asynchronous way The parser will correctly locate the coda by intersecting the nasal cluster...
- 7
- 420
- 0
Basel III: A global regulatory framework for more resilient banks and banking systems pot
... from Argentina, Australia, Belgium, Brazil, Canada, China, France, Germany, Hong Kong SAR, India, Indonesia, Italy, Japan, Korea, Luxembourg, Mexico, the Netherlands, Russia, Saudi Arabia, Singapore, ... The standardised CVA risk capital charge determined by paragraph 104 In addition, the following paragraph will be inserted after paragraph in Annex “Outstanding EAD” for a given OTC derivative ... CVA capital charge or in the standardised CVA risk capital charge set forth in paragraph 104 For example, if a credit default swap (CDS) referencing an issuer is in the bank’s inventory and that...
- 77
- 1,998
- 1
Báo cáo khoa học: "A Unified Statistical Model for the Identification of English BaseNP" pptx
... treebank grammas for baseNP identification In th Proceedings of the 36 International Conference on Computational Linguistics, pp.218-224 COLING-ACL’98 Lance A Ramshaw and Michael P Marcus ( In ... Press) Text chunking using transformation-based learning In Natural Language Processing Using Very large Corpora Kluwer Originally appeared in The second workshop on very large corpora WVLC’95, pp.82-94 ... different POS tagging results way the size of the training data becomes larger and larger In those cases the testing data is always section 20 (which is excluded from the training data) From Figure...
- 8
- 482
- 0
Báo cáo khoa học: A pre-docking role for microtubules in insulin-stimulated glucose transporter 4 translocation ppt
... has a functional Rab GTPase-activating protein domain Biochem J 391, 87–93 Larance M, Ramm G, Stockli J, van Dam EM, Winata S, Wasinger V, Simpson F, Graham M, Junutula JR, Guilhaus M et al (2005) ... Kane S, Sano H, Liu SC, Asara JM, Lane WS, Garner CC & Lienhard GE (2002) A method to identify serine kinase substrates Akt phosphorylates a novel adipocyte protein with a Rab GTPase-activating ... (1996) Activated phosphatidylinositol 3-kinase is sufficient to mediate actin rearrangement and GLUT4 translocation in 3T3-L1 adipocytes J Biol Chem 271, 17605–17608 Okada T, Kawano Y, Sakakibara T,...
- 8
- 420
- 0
Báo cáo khoa học: "A Risk Minimization Framework for Extractive Speech Summarization" doc
... exploring different modeling approaches for this framework, 3) investigating discriminative training criteria for training the component models in this framework, and 4) extending and applying ... Shih-Hsiang Lin, Berlin Chen and Hsin-Min Wang 2009 A comparative study of probabilistic ranking models for Chinese spoken document summarization ACM Transactions on Asian Language Information ... statistical machine translation (Kumar and Byrne, 2004) and statistical information retrieval (Zhai and Lafferty, 2006) Following the same spirit, we formulate the extractive summarization task...
- 9
- 361
- 0
Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx
... CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC GGAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC GGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG ... 2a+ 2b+ 2– 3+wt 3+YIRN 3– TAATACGACTCACTATAGGGAGACCACAACGGTTTCC GGGCaagcTTCCCCGTCTCCtCCAGGATCATCtTCCCG GGGCAAgcttgCTaTTcCCTCCTACTCCTcTTACGGATGCTACTGCGGCtgGGGGGG GACTGCAaCCCCAAAtCGGACAG CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC ... GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG GGAATTCTGCAGTTAGCATTTgagCTCtccCTTGCACAAgAAGTCCGG Ó FEBS 2003 3020 P Prijatelj et al (Eur J Biochem 270) Vista, CA), digested with BamHI/HindIII (fragment 1, 60 bp), HindIII/EcoRI...
- 8
- 401
- 0
Báo cáo khoa học: "A Model-Theoretic Framework for Theories of Syntax" pdf
... of all analyses that can occur in human languages The principles then distinguish particular sub-languages the head-final or the pro-drop languages, for instance Each realized human language is ... Language and Information Kracht, Marcus 1995 Syntactic codes and grammar refinement Journal of Logic, Language, and Information, 4:41-60 Manzini, Maria Rita 1992 Locality: A Theory and Some of ... guages in a class The regular languages, for instance, can be characterized by finite-state (string) a u t o m a t a - - t h e s e languages can be processed using a fixed amount of memory...
- 7
- 390
- 0
Báo cáo khoa học: "Automatic Story Segmentation using a Bayesian Decision Framework for Statistical Models of Lexical Chain Features" pdf
... approach in (Chan et al 2007) based on the training data The optimal value is found to be 130.9sec for long programs We make use of three lexical chain features: chain starts, continuations and ... of seeing a lexical chain start / end at a particular instance is independent of the starts / ends of other chains As a result, the probability of seeing a sequence of chain starts at a story ... Modeling of Lexical Chain Features Chain starts and ends We follow (Chan et al 2007) to model the lexical chain starts and ends at a story boundary with a statistical distribution We apply a window...
- 4
- 402
- 1
Báo cáo khoa học: "A Multi-resolution Framework for Information Extraction from Free Text" pptx
... PropBank and AQUAINT as the training and testing corpora, respectively Since the relation edges have a form Target k -> Arg l , the relation path in semantic frame contains only a single relation ... of anchor pair A i and A j 5.3 Evaluation of templates At this stage, we have a set of accepted integral relation paths between any anchor pair A i and A j The next task is to merge appropriate ... using Syntactic and Lexical Information In Proc of HLT/NAACL M Surdeanu, S Harabagiu, J Williams, P Aarseth 2003 Using Predicate Arguments Structures for Information Extraction In Proc of ACL-2003...
- 8
- 345
- 0
Báo cáo khoa học: "A Probabilistic Modeling Framework for Lexical Entailment" potx
... Paraphrasing Andrew MacKinlay and Timothy Baldwin 2009 A baseline approach to the RTE5 search pilot In Proceedings of Text Analysis Conference (TAC) Debarghya Majumdar and Pushpak Bhattacharyya 2010 ... American Association for Computational Linguistics Houping Jia, Xiaojiang Huang, Tengfei Ma, Xiaojun Wan, and Jianguo Xiao 2010 PKUTM participation at TAC 2010 RTE and summarization track In Proceedings ... Language Processing, pages 172–179 Association for Computational Linguistics Nizar Habash and Bonnie Dorr 2003 A categorial variation database for english In Proceedings of the North American...
- 6
- 376
- 0
Báo cáo khoa học: "A Metric-based Framework for Automatic Taxonomy Induction" potx
... learning separate information functions for terms at different abstraction levels We approximate an information function by a linear interpolation of some underlying feature functions Each abstraction ... generate training data, and test on the remaining dataset We repeat the process for 50 times, with different training and test sets at each Feature is -a sibling Contextual Co-occur Patterns Syntactic ... induction As we mentioned earlier, two main approaches are patternbased and clustering-based Pattern-based approaches are the main trend for automatic taxonomy induction Though suffering from...
- 9
- 339
- 0
báo cáo hóa học: " A decision support framework for the discrimination of children with controlled epilepsy based on EEG analysis" pdf
... the bivariate case and are calculated for each brain region (lobe) assuming again a preselected lobe scheme that contain grouped channel pairs instead of single channels The lobes (channel pair ... significant spectral differences within the frontal left lobes of Alpha and Gamma2 band and central lobes of the Alpha band Alterations in the Alpha band are also expected since they are generally associated ... both Task and 2, are shown in the form of bar graphs in Figures and A linear discriminant analysis (LDA) classifier with the leave- Bivariate synchronization analysis The MS-COH and AR-COH measures...
- 14
- 454
- 0
Báo cáo hóa học: "Research Article The Waterfilling Game-Theoretical Framework for Distributed Wireless Network Information Flow" pptx
... two random variables, and each row contains at least one random variable Again we can transform C in row echelon form, denoted as Cr Note that the rank of Cr is ξ2 with probability 1, since each ... Potential Game Approach Fortunately, our game G can be studied as a potential game (The notation of potential games was firstly used for games in strategic form by Rosenthal (1973) [24], and later ... channel fading statistics and the number of players of the investigated channel setting, as is apparent from the comparison of the results in [9– 11] We show that, for a quasi-static fading channel...
- 13
- 278
- 0
Báo cáo hóa học: " SeGrid: A Secure Grid Framework for Sensor Networks" docx
... based on node IDs, and therefore mutual authentication can be realized after deployment since all keys are unique and each is associated with a pair of nodes A path key can be established with the ... distributes keying information to at most λ worker sensors through an asymmetric secure channel established by Rabin’s algorithm [28] Compared to iPAK, SBK is “perfect” against node capture attack, achieves ... message dissemination and keying information storage When a grid head needs to be replaced due to reasons such as power depletion, it can delegate another active sensor as the new grid head and...
- 11
- 339
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008